GHITM cdna clone
GHITM cDNA Clone
Gene Names
GHITM; DERP2; MICS1; My021; PTD010; TMBIM5; HSPC282
Synonyms
GHITM; GHITM cDNA Clone; GHITM cdna clone
Sequence
atgttggctgcaaggctggtgtgtctccggacactaccttctagggttttccacccagctttcaccaaggcctcccctgttgtgaagaattccatcacgaagaatcaatggctgttaacacctagcagggaatatgccaccaaaacaagaattgggatccggcgtgggagaactggccaagaactcaaagaggcagcattggaaccatcgatggaaaaaatatttaaaattgatcagatgggaagatggtttgttgctggaggggctgctgttggtcttggagcattgtgctactatggcttgggactgtctaatgagattggagctattgaaaaggctgtaatttggcctcagtatgtcaaggatagaattcattccacctatatgtacttagcagggagtattggtttaacagctttgtctgccatagcaatcagcagaacgcctgttctcatgaacttcatgatgagaggctcttgggtgacaattggtgtgacctttgcagccatggttggagctggaatgctggtacgatcaataccatatgaccagagcccaggcccaaagcatcttgcttggttgctacattctggtgtgatgggtgcagtggtggctcctctgacaatattagggggtcctcttctcatcagagctgcatggtacacagctggcattgtgggaggcctctccactgtggccatgtgtgcgcccagtgaaaagtttctgaacatgggtgcacccctgggagtgggcctgggtctcgtctttgtgtcctcattgggatctatgtttcttccacctaccaccgtggctggtgccactctttactcagtggcaatgtacggtggattagttcttttcagcatgttccttctgtatgatacccagaaagtaatcaagcgtgcagaagtatcaccaatgtatggagttcaaaaatatgatcccattaactcgatgctgagtatctacatggatacattaaatatatttatgcgagttgcaactatgctggcaactggaggcaacagaaagaaatga
Sequence Length
1038
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,205 Da
NCBI Official Full Name
Homo sapiens growth hormone inducible transmembrane protein, mRNA
NCBI Official Synonym Full Names
growth hormone inducible transmembrane protein
NCBI Official Symbol
GHITM
NCBI Official Synonym Symbols
DERP2; MICS1; My021; PTD010; TMBIM5; HSPC282
NCBI Protein Information
growth hormone-inducible transmembrane protein
UniProt Protein Name
Growth hormone-inducible transmembrane protein
Protein Family
UniProt Gene Name
GHITM
UniProt Synonym Gene Names
DERP2; MICS1; TMBIM5; MICS1
UniProt Entry Name
GHITM_HUMAN
Uniprot Description
GHITM: Required for the mitochondrial tubular network and cristae organization. Involved in apoptotic release of cytochrome c. Belongs to the BI1 family.
Protein type: Mitochondrial; Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 10q23.1
Molecular Function: protein binding
Research Articles on GHITM
Similar Products
Product Notes
The GHITM ghitm (Catalog #AAA1271691) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggctg caaggctggt gtgtctccgg acactacctt ctagggtttt ccacccagct ttcaccaagg cctcccctgt tgtgaagaat tccatcacga agaatcaatg gctgttaaca cctagcaggg aatatgccac caaaacaaga attgggatcc ggcgtgggag aactggccaa gaactcaaag aggcagcatt ggaaccatcg atggaaaaaa tatttaaaat tgatcagatg ggaagatggt ttgttgctgg aggggctgct gttggtcttg gagcattgtg ctactatggc ttgggactgt ctaatgagat tggagctatt gaaaaggctg taatttggcc tcagtatgtc aaggatagaa ttcattccac ctatatgtac ttagcaggga gtattggttt aacagctttg tctgccatag caatcagcag aacgcctgtt ctcatgaact tcatgatgag aggctcttgg gtgacaattg gtgtgacctt tgcagccatg gttggagctg gaatgctggt acgatcaata ccatatgacc agagcccagg cccaaagcat cttgcttggt tgctacattc tggtgtgatg ggtgcagtgg tggctcctct gacaatatta gggggtcctc ttctcatcag agctgcatgg tacacagctg gcattgtggg aggcctctcc actgtggcca tgtgtgcgcc cagtgaaaag tttctgaaca tgggtgcacc cctgggagtg ggcctgggtc tcgtctttgt gtcctcattg ggatctatgt ttcttccacc taccaccgtg gctggtgcca ctctttactc agtggcaatg tacggtggat tagttctttt cagcatgttc cttctgtatg atacccagaa agtaatcaag cgtgcagaag tatcaccaat gtatggagtt caaaaatatg atcccattaa ctcgatgctg agtatctaca tggatacatt aaatatattt atgcgagttg caactatgct ggcaactgga ggcaacagaa agaaatga. It is sometimes possible for the material contained within the vial of "GHITM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
