Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GGT1 cdna clone

GGT1 cDNA Clone

Gene Names
GGT1; GGT; GTG; CD224; GGT 1; D22S672; D22S732
Synonyms
GGT1; GGT1 cDNA Clone; GGT1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGACCTCCGAGTTCTTCGCTGCCCAGCTCCGGGCCCAGATCTCTGACGACACCACTCACCCGATCTCCTACTACAAGCCCGAGTTCTACACGCCGGATGACGGGGGCACTGCTCACCTGTCTGTCGTCGCAGAGGACGGCAGTGCTGTGTCCGCCACCAGCACCATCAACCTCTACTTTGGCTCCAAGGTCCGCTCCCCGGTCAGCGGGATCCTGTTCAATAATGAAATGGACGACTTCAGCTCTCCCAGCATCACCAACGAGTTTGGGGTACCCCCCTCACCTGCCAATTTCATCCAGCCAGGGAAGCAGCCGCTCTCGTCCATGTGCCCGACGATCATGGTGGGCCAGGACGGCCAGGTCCGGATGGTGGTGGGAGCTGCTGGGGGCACACAGATCACCACGGCCACTGCACTGGCCATCATCTACAACCTCTGGTTCGGCTATGACGTGAAGCGGGCCGTGGAGGAGCCCCGGCTGCACAACCAGCTTCTGCCCAACGTCACGACAGTGGAGAGAAACATTGACCAGGCAGTGACTGCAGCCCTGGAGACCCGGCACCATCACACCCAGATCGCGTCCACCTTCATCGCTGTGGTGCAAGCCATCGTCCGCACGGCTGGTGGCTGGGCAGCTGCCTCGGACTCCAGGAAAGGCGGGGAGCCTGCCGGCTACTGA
Sequence Length
678
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,080 Da
NCBI Official Full Name
Homo sapiens gamma-glutamyltransferase 1, mRNA
NCBI Official Synonym Full Names
gamma-glutamyltransferase 1
NCBI Official Symbol
GGT1
NCBI Official Synonym Symbols
GGT; GTG; CD224; GGT 1; D22S672; D22S732
NCBI Protein Information
gamma-glutamyltranspeptidase 1
UniProt Protein Name
Gamma-glutamyltranspeptidase 1
UniProt Gene Name
GGT1
UniProt Synonym Gene Names
GGT; GGT 1
UniProt Entry Name
GGT1_HUMAN

NCBI Description

The enzyme encoded by this gene is a type I gamma-glutamyltransferase that catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. The enzyme is composed of a heavy chain and a light chain, which are derived from a single precursor protein. It is expressed in tissues involved in absorption and secretion and may contribute to the etiology of diabetes and other metabolic disorders. Multiple alternatively spliced variants have been identified. There are a number of related genes present on chromosomes 20 and 22, and putative pseudogenes for this gene on chromosomes 2, 13, and 22. [provided by RefSeq, Jan 2014]

Uniprot Description

GGT1: Initiates extracellular glutathione (GSH) breakdown, provides cells with a local cysteine supply and contributes to maintain intracellular GSH level. It is part of the cell antioxidant defense mechanism. Catalyzes the transfer of the glutamyl moiety of glutathione to amino acids and dipeptide acceptors. Alternatively, glutathione can be hydrolyzed to give Cys-Gly and gamma glutamate. Isoform 3 seems to be inactive. Defects in GGT1 are a cause of glutathionuria (GLUTH); also known as gamma-glutamyltranspeptidase deficiency. It is an autosomal recessive disease. Belongs to the gamma-glutamyltransferase family. 3 isoforms of the human protein are produced by alternative promoter.

Protein type: Other Amino Acids Metabolism - selenoamino acid; Other Amino Acids Metabolism - cyanoamino acid; Membrane protein, integral; Other Amino Acids Metabolism - taurine and hypotaurine; Lipid Metabolism - arachidonic acid; EC 3.4.19.13; EC 3.4.19.14; EC 2.3.2.2; Other Amino Acids Metabolism - glutathione; Transferase

Chromosomal Location of Human Ortholog: 22q11.23

Cellular Component: anchored to external side of plasma membrane; extracellular space; plasma membrane

Molecular Function: gamma-glutamyltransferase activity; protein binding

Biological Process: amino acid metabolic process; cysteine biosynthetic process; glutamate metabolic process; glutathione biosynthetic process; glutathione catabolic process; glutathione metabolic process; leukotriene biosynthetic process; leukotriene metabolic process; regulation of immune system process; regulation of inflammatory response; spermatogenesis; xenobiotic metabolic process; zymogen activation

Disease: Glutathionuria

Research Articles on GGT1

Similar Products

Product Notes

The GGT1 ggt1 (Catalog #AAA1275339) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGACCTCCG AGTTCTTCGC TGCCCAGCTC CGGGCCCAGA TCTCTGACGA CACCACTCAC CCGATCTCCT ACTACAAGCC CGAGTTCTAC ACGCCGGATG ACGGGGGCAC TGCTCACCTG TCTGTCGTCG CAGAGGACGG CAGTGCTGTG TCCGCCACCA GCACCATCAA CCTCTACTTT GGCTCCAAGG TCCGCTCCCC GGTCAGCGGG ATCCTGTTCA ATAATGAAAT GGACGACTTC AGCTCTCCCA GCATCACCAA CGAGTTTGGG GTACCCCCCT CACCTGCCAA TTTCATCCAG CCAGGGAAGC AGCCGCTCTC GTCCATGTGC CCGACGATCA TGGTGGGCCA GGACGGCCAG GTCCGGATGG TGGTGGGAGC TGCTGGGGGC ACACAGATCA CCACGGCCAC TGCACTGGCC ATCATCTACA ACCTCTGGTT CGGCTATGAC GTGAAGCGGG CCGTGGAGGA GCCCCGGCTG CACAACCAGC TTCTGCCCAA CGTCACGACA GTGGAGAGAA ACATTGACCA GGCAGTGACT GCAGCCCTGG AGACCCGGCA CCATCACACC CAGATCGCGT CCACCTTCAT CGCTGTGGTG CAAGCCATCG TCCGCACGGC TGGTGGCTGG GCAGCTGCCT CGGACTCCAG GAAAGGCGGG GAGCCTGCCG GCTACTGA. It is sometimes possible for the material contained within the vial of "GGT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.