Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GFRA2 cdna clone

GFRA2 cDNA Clone

Gene Names
GFRA2; NTNRA; RETL2; TRNR2; GDNFRB; NRTNR-ALPHA
Synonyms
GFRA2; GFRA2 cDNA Clone; GFRA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgatcttggcaaacgtcttctgcctcttcttctttctagacgagaccctccgctctttggccagcccttcctccctgcagggccccgagctccacggctggcgccccccagtggactgtgtccgggccaatgagctgtgtgccgccgaatccaactgcagctctcgctaccgcactctgcggcagtgcctggcaggccgcgaccgcaacaccatgctggccaacaaggagtgccaggcggccttggaggtcttgcaggagagcccgctgtacgactgccgctgcaagcggggcatgaagaaggagctgcagtgtctgcagatctactggagcatccacctggggctgaccgagggtgaggagttctacgaagcctccccctatgagccggtgacctcccgcctctcggacatcttcaggcttgcttcaatcttctcagggacaggggcagacccggtggtcagcgccaagagcaaccattgcctggatgctgccaaggcctgcaacctgaatgacaactgcaagaagctgcgctcctcctacatctccatctgcaaccgcgagatctcgcccaccgagcgctgcaaccgccgcaagtgccacaaggccctgcgccagttcttcgaccgggtgcccagcgagtacacctaccgcatgctcttctgctcctgccaagaccaggcgtgcgctgagcgccgccggcaaaccatcctgcccagctgctcctatgaggacaaggagaagcccaactgcctggacctgcgtggcgtgtgccggactgaccacctgtgtcggtcccggctggccgacttccatgccaattgtcgagcctcctaccagacggtcaccagctgccctgcggacaattaccaggcgtgtctgggctcttatgctggcatgattgggtttgacatgacacctaactatgtggactccagccccactggcatcgtggtgtccccctggtgcagctgtcgtggcagcgggaacatggaggaggagtgtgagaagttcctcagggacttcaccgagaacccatgcctccggaacgccatccaggcctttggcaacggcacggacgtgaacgtgtccccaaaaggcccctcgttccaggccacccaggcccctcgggtggagaagacgccttctttgccagatgacctcagtgacagtaccagcttggggaccagtgtcatcaccacctgcacgtctgtccaggagcaggggctgaaggccaacaactccaaagagttaagcatgtgcttcacagagctcacgacaaatatcatcccagggagtaacaaggtgatcaaacctaactcaggccccagcagagccagaccgtcggctgccttgaccgtgctgtctgtcctgatgctgaaactggccttgtag
Sequence Length
1395
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,649 Da
NCBI Official Full Name
Homo sapiens GDNF family receptor alpha 2, mRNA
NCBI Official Synonym Full Names
GDNF family receptor alpha 2
NCBI Official Symbol
GFRA2
NCBI Official Synonym Symbols
NTNRA; RETL2; TRNR2; GDNFRB; NRTNR-ALPHA
NCBI Protein Information
GDNF family receptor alpha-2
UniProt Protein Name
GDNF family receptor alpha-2
Protein Family
UniProt Gene Name
GFRA2
UniProt Synonym Gene Names
GDNFRB; RETL2; TRNR2; GDNF receptor alpha-2; GDNFR-alpha-2; GFR-alpha-2; GDNFR-beta; NRTNR-alpha; NTNR-alpha
UniProt Entry Name
GFRA2_HUMAN

NCBI Description

Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

GFRA2: Receptor for neurturin. Mediates the NRTN-induced autophosphorylation and activation of the RET receptor. Also able to mediate GDNF signaling through the RET tyrosine kinase receptor. Belongs to the GDNFR family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 8p21.3

Cellular Component: extrinsic to membrane; plasma membrane

Molecular Function: Ras guanyl-nucleotide exchange factor activity

Biological Process: MAPKKK cascade; transmembrane receptor protein tyrosine kinase signaling pathway

Research Articles on GFRA2

Similar Products

Product Notes

The GFRA2 gfra2 (Catalog #AAA1269082) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcttgg caaacgtctt ctgcctcttc ttctttctag acgagaccct ccgctctttg gccagccctt cctccctgca gggccccgag ctccacggct ggcgcccccc agtggactgt gtccgggcca atgagctgtg tgccgccgaa tccaactgca gctctcgcta ccgcactctg cggcagtgcc tggcaggccg cgaccgcaac accatgctgg ccaacaagga gtgccaggcg gccttggagg tcttgcagga gagcccgctg tacgactgcc gctgcaagcg gggcatgaag aaggagctgc agtgtctgca gatctactgg agcatccacc tggggctgac cgagggtgag gagttctacg aagcctcccc ctatgagccg gtgacctccc gcctctcgga catcttcagg cttgcttcaa tcttctcagg gacaggggca gacccggtgg tcagcgccaa gagcaaccat tgcctggatg ctgccaaggc ctgcaacctg aatgacaact gcaagaagct gcgctcctcc tacatctcca tctgcaaccg cgagatctcg cccaccgagc gctgcaaccg ccgcaagtgc cacaaggccc tgcgccagtt cttcgaccgg gtgcccagcg agtacaccta ccgcatgctc ttctgctcct gccaagacca ggcgtgcgct gagcgccgcc ggcaaaccat cctgcccagc tgctcctatg aggacaagga gaagcccaac tgcctggacc tgcgtggcgt gtgccggact gaccacctgt gtcggtcccg gctggccgac ttccatgcca attgtcgagc ctcctaccag acggtcacca gctgccctgc ggacaattac caggcgtgtc tgggctctta tgctggcatg attgggtttg acatgacacc taactatgtg gactccagcc ccactggcat cgtggtgtcc ccctggtgca gctgtcgtgg cagcgggaac atggaggagg agtgtgagaa gttcctcagg gacttcaccg agaacccatg cctccggaac gccatccagg cctttggcaa cggcacggac gtgaacgtgt ccccaaaagg cccctcgttc caggccaccc aggcccctcg ggtggagaag acgccttctt tgccagatga cctcagtgac agtaccagct tggggaccag tgtcatcacc acctgcacgt ctgtccagga gcaggggctg aaggccaaca actccaaaga gttaagcatg tgcttcacag agctcacgac aaatatcatc ccagggagta acaaggtgat caaacctaac tcaggcccca gcagagccag accgtcggct gccttgaccg tgctgtctgt cctgatgctg aaactggcct tgtag. It is sometimes possible for the material contained within the vial of "GFRA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.