Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GEMIN8 cdna clone

GEMIN8 cDNA Clone

Gene Names
GEMIN8; FAM51A1
Synonyms
GEMIN8; GEMIN8 cDNA Clone; GEMIN8 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcggtaaaggcatcaacatcgaaagctaccaggccttggtattctcatccggtatatgcaagatactggcaacattatcatcaagcaatggcttggatgcaaagccatcacaatgcctacaggaaggccgtggaatcctgtttcaatcttccatggtacttaccttctgcgcttcttccccaaagctcttacgataatgaggctgcgtatcctcagtccttctatgaccatcatgtggcctggcaggactacccctgcagttcttcacatttcagaagatctgggcagcatccacgttacagcagtaggatccaggcatccacaaaagaagaccaagctttgtccaaagaggaagagatggagactgagtcagatgcagaggtagaatgtgacctgagcaatatggaaatcactgaagagctccgccagtactttgcagagaccgagaggcatagagaagaacgacggcggcagcagcagctggatgcagagcgcctggacagctatgtgaacgctgaccacgacctgtactgcaacacccgccggtcggtagaagccccaactgagaggcctggtgagcggcgccaggccgagatgaagcgtttgtacggggacagtgctgccaagatccaagccatggaggccgcggtgcagctgagctttgacaagcactgtgaccgaaagcagcccaagtactggccggtcatccccctgaagttctga
Sequence Length
729
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,637 Da
NCBI Official Full Name
Homo sapiens gem (nuclear organelle) associated protein 8, mRNA
NCBI Official Synonym Full Names
gem nuclear organelle associated protein 8
NCBI Official Symbol
GEMIN8
NCBI Official Synonym Symbols
FAM51A1
NCBI Protein Information
gem-associated protein 8
UniProt Protein Name
Gem-associated protein 8
Protein Family
UniProt Gene Name
GEMIN8
UniProt Synonym Gene Names
FAM51A1; Gemin-8
UniProt Entry Name
GEMI8_HUMAN

NCBI Description

The protein encoded by this gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The encoded protein binds to both SMN1 and the GEMIN6/GEMIN7 heterodimer, mediating their interaction. This protein is found in nuclear Gemini of Cajal bodies (gems) and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]

Uniprot Description

GEMIN8: The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus.

Protein type: RNA splicing; RNA-binding

Chromosomal Location of Human Ortholog: Xp22.2

Cellular Component: cytoplasm; cytosol; nucleus; SMN complex

Molecular Function: protein binding

Biological Process: spliceosomal snRNP biogenesis

Research Articles on GEMIN8

Similar Products

Product Notes

The GEMIN8 gemin8 (Catalog #AAA1278717) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcgg taaaggcatc aacatcgaaa gctaccaggc cttggtattc tcatccggta tatgcaagat actggcaaca ttatcatcaa gcaatggctt ggatgcaaag ccatcacaat gcctacagga aggccgtgga atcctgtttc aatcttccat ggtacttacc ttctgcgctt cttccccaaa gctcttacga taatgaggct gcgtatcctc agtccttcta tgaccatcat gtggcctggc aggactaccc ctgcagttct tcacatttca gaagatctgg gcagcatcca cgttacagca gtaggatcca ggcatccaca aaagaagacc aagctttgtc caaagaggaa gagatggaga ctgagtcaga tgcagaggta gaatgtgacc tgagcaatat ggaaatcact gaagagctcc gccagtactt tgcagagacc gagaggcata gagaagaacg acggcggcag cagcagctgg atgcagagcg cctggacagc tatgtgaacg ctgaccacga cctgtactgc aacacccgcc ggtcggtaga agccccaact gagaggcctg gtgagcggcg ccaggccgag atgaagcgtt tgtacgggga cagtgctgcc aagatccaag ccatggaggc cgcggtgcag ctgagctttg acaagcactg tgaccgaaag cagcccaagt actggccggt catccccctg aagttctga. It is sometimes possible for the material contained within the vial of "GEMIN8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.