Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GEM cdna clone

GEM cDNA Clone

Gene Names
GEM; KIR
Synonyms
GEM; GEM cDNA Clone; GEM cdna clone
Ordering
For Research Use Only!
Sequence
atgactctgaataatgtcaccatgcgccagggcactgtgggcatgcagccacagcagcagcgctggagcatcccagctgatggcaggcatctgatggtccagaaagagccccaccagtacagccaccgcaaccgccattctgctacccctgaggaccactgccgccgaagctggtcctctgactccacagactcagtcatctcctctgagtcagggaacacctactaccgagtggtgctcataggggagcagggggtgggcaagtccactctggccaacatctttgcaggtgtgcatgacagcatggacagcgactgcgaggtgctgggagaagatacatatgaacgaaccctgatggttgatggggaaagtgcaacgattatactcctggatatgtgggaaaataagggggaaaatgaatggctccatgaccactgcatgcaggtcggggacgcatacctgattgtctactcaatcacagaccgagcgagcttcgagaaggcatctgagctgcgaatccagctccgcagggcccggcagacagaggacattcccataattttggttggcaacaaaagtgacttagtgcggtgccgagaagtgtctgtatcagaagggagagcctgtgcagtggtgtttgactgcaagttcatcgagacctctgcagctgtccagcacaacgtgaaggagctgtttgagggcattgtgcgacaggtgcgccttcggcgggacagcaaggagaagaatgaacggcggctggcctaccagaaaaggaaggagagcatgcccaggaaagccaggcgcttctggggcaagatcgtggccaaaaacaacaagaatatggccttcaagctcaagtccaaatcctgccatgacctctctgtactctag
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,949 Da
NCBI Official Full Name
Homo sapiens GTP binding protein overexpressed in skeletal muscle, mRNA
NCBI Official Synonym Full Names
GTP binding protein overexpressed in skeletal muscle
NCBI Official Symbol
GEM
NCBI Official Synonym Symbols
KIR
NCBI Protein Information
GTP-binding protein GEM
UniProt Protein Name
GTP-binding protein GEM
Protein Family
UniProt Gene Name
GEM
UniProt Synonym Gene Names
KIR
UniProt Entry Name
GEM_HUMAN

NCBI Description

The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

GEM: Could be a regulatory protein, possibly participating in receptor-mediated signal transduction at the plasma membrane. Has guanine nucleotide-binding activity but undetectable intrinsic GTPase activity. Belongs to the small GTPase superfamily. RGK family.

Protein type: G protein, monomeric, RGK; G protein, monomeric; G protein

Chromosomal Location of Human Ortholog: 8q13-q21

Cellular Component: internal side of plasma membrane; midbody; spindle midzone

Molecular Function: GDP binding; GTP binding; GTPase activity; magnesium ion binding; protein binding

Biological Process: cell surface receptor linked signal transduction; chromosome organization and biogenesis; immune response; metaphase plate congression; mitosis; signal transduction

Research Articles on GEM

Similar Products

Product Notes

The GEM gem (Catalog #AAA1265634) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactctga ataatgtcac catgcgccag ggcactgtgg gcatgcagcc acagcagcag cgctggagca tcccagctga tggcaggcat ctgatggtcc agaaagagcc ccaccagtac agccaccgca accgccattc tgctacccct gaggaccact gccgccgaag ctggtcctct gactccacag actcagtcat ctcctctgag tcagggaaca cctactaccg agtggtgctc ataggggagc agggggtggg caagtccact ctggccaaca tctttgcagg tgtgcatgac agcatggaca gcgactgcga ggtgctggga gaagatacat atgaacgaac cctgatggtt gatggggaaa gtgcaacgat tatactcctg gatatgtggg aaaataaggg ggaaaatgaa tggctccatg accactgcat gcaggtcggg gacgcatacc tgattgtcta ctcaatcaca gaccgagcga gcttcgagaa ggcatctgag ctgcgaatcc agctccgcag ggcccggcag acagaggaca ttcccataat tttggttggc aacaaaagtg acttagtgcg gtgccgagaa gtgtctgtat cagaagggag agcctgtgca gtggtgtttg actgcaagtt catcgagacc tctgcagctg tccagcacaa cgtgaaggag ctgtttgagg gcattgtgcg acaggtgcgc cttcggcggg acagcaagga gaagaatgaa cggcggctgg cctaccagaa aaggaaggag agcatgccca ggaaagccag gcgcttctgg ggcaagatcg tggccaaaaa caacaagaat atggccttca agctcaagtc caaatcctgc catgacctct ctgtactcta g. It is sometimes possible for the material contained within the vial of "GEM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.