Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GDF3 cdna clone

GDF3 cDNA Clone

Gene Names
GDF3; KFS3; MCOP7; MCOPCB6
Synonyms
GDF3; GDF3 cDNA Clone; GDF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcttcgtttcttgccagatttggctttcagcttcctgttaattctggctttgggccaggcagtccaatttcaagaatatgtctttctccaatttctgggcttagataaggcgccttcaccccagaagttccaacctgtgccttatatcttgaagaaaattttccaggatcgcgaggcagcagcgaccactggggtctcccgagacttatgctacgtaaaggagctgggcgtccgcgggaatgtacttcgctttctcccagaccaaggtttctttctttacccaaagaaaatttcccaagcttcctcctgcctgcagaagctcctctactttaacctgtctgccatcaaagaaagggaacagttgacattggcccagctgggcctggacttggggcccaattcttactataacctgggaccagagctggaactggctctgttcctggttcaggagcctcatgtgtggggccagaccacccctaagccaggtaaaatgtttgtgttgcggtcagtcccatggccacaaggtgctgttcacttcaacctgctggatgtagctaaggattggaatgacaacccccggaaaaatttcgggttattcctggagatactggtcaaagaagatagagactcaagggtgaattttcagcctgaagacacctgtgccagactaagatgctcccttcatgcttccctgctggtggtgactctcaaccctgatcagtgccacccttctcggaaaaggagagcagccatccctgtccccaagctttcttgtaagaacctctgccaccgtcaccagctattcattaacttccgggacctgggttggcacaagtggatcattgcccccaaggggttcatggcaaattactgccatggagagtgtcccttctcactgaccatctctctcaacagctccaattatgctttcatgcaagccctgatgcatgccgttgacccagagatcccccaggctgtgtgtatccccaccaagctgtctcccatttccatgctctaccaggacaataatgacaatgtcattctacgacattatgaagacatggtagtcgatgaatgtgggtgtgggtag
Sequence Length
1095
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,387 Da
NCBI Official Full Name
Homo sapiens growth differentiation factor 3, mRNA
NCBI Official Synonym Full Names
growth differentiation factor 3
NCBI Official Symbol
GDF3
NCBI Official Synonym Symbols
KFS3; MCOP7; MCOPCB6
NCBI Protein Information
growth/differentiation factor 3
UniProt Protein Name
Growth/differentiation factor 3
UniProt Gene Name
GDF3
UniProt Synonym Gene Names
GDF-3
UniProt Entry Name
GDF3_HUMAN

NCBI Description

The protein encoded by this gene is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. [provided by RefSeq, Jul 2008]

Uniprot Description

GDF3: Defects in GDF3 are the cause of Klippel-Feil syndrome type 3 (KFS3); also called Klippel-Feil syndrome autosomal dominant 3. KFS3 is a skeletal disorder characterized by congenital fusion of cervical vertebrae. It is due to a failure in the normal segmentation of vertebrae during the early weeks of fetal development. The clinical triad consists of short neck, low posterior hairline, and limited neck movement. Defects in GDF3 are the cause of microphthalmia isolated with coloboma type 6 (MCOPCB6); also called isolated colobomatous microphthalmia 6. MCOPCB6 is a disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues. Ocular abnormalities like opacities of the cornea and lens, scaring of the retina and choroid, cataract and other abnormalities like cataract may also be present. Ocular colobomas are a set of malformations resulting from abnormal morphogenesis of the optic cup and stalk, and the fusion of the fetal fissure (optic fissure). Defects in GDF3 are a cause of microphthalmia isolated type 7 (MCOP7). MCOP7 is a disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues. Ocular abnormalities like opacities of the cornea and lens, scaring of the retina and choroid, cataract and other abnormalities like cataract may also be present. Belongs to the TGF-beta family.

Protein type: Secreted; Secreted, signal peptide; Cytokine

Chromosomal Location of Human Ortholog: 12p13.1

Cellular Component: cytoplasm; extracellular space

Molecular Function: cytokine activity; protein kinase binding; transforming growth factor beta receptor binding

Biological Process: cell development; eye development; negative regulation of BMP signaling pathway; negative regulation of epidermal cell differentiation; regulation of apoptosis; regulation of cell fate commitment; regulation of MAPKKK cascade; skeletal development

Disease: Klippel-feil Syndrome 3, Autosomal Dominant; Microphthalmia, Isolated 7; Microphthalmia, Isolated, With Coloboma 6

Research Articles on GDF3

Similar Products

Product Notes

The GDF3 gdf3 (Catalog #AAA1266275) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttcgtt tcttgccaga tttggctttc agcttcctgt taattctggc tttgggccag gcagtccaat ttcaagaata tgtctttctc caatttctgg gcttagataa ggcgccttca ccccagaagt tccaacctgt gccttatatc ttgaagaaaa ttttccagga tcgcgaggca gcagcgacca ctggggtctc ccgagactta tgctacgtaa aggagctggg cgtccgcggg aatgtacttc gctttctccc agaccaaggt ttctttcttt acccaaagaa aatttcccaa gcttcctcct gcctgcagaa gctcctctac tttaacctgt ctgccatcaa agaaagggaa cagttgacat tggcccagct gggcctggac ttggggccca attcttacta taacctggga ccagagctgg aactggctct gttcctggtt caggagcctc atgtgtgggg ccagaccacc cctaagccag gtaaaatgtt tgtgttgcgg tcagtcccat ggccacaagg tgctgttcac ttcaacctgc tggatgtagc taaggattgg aatgacaacc cccggaaaaa tttcgggtta ttcctggaga tactggtcaa agaagataga gactcaaggg tgaattttca gcctgaagac acctgtgcca gactaagatg ctcccttcat gcttccctgc tggtggtgac tctcaaccct gatcagtgcc acccttctcg gaaaaggaga gcagccatcc ctgtccccaa gctttcttgt aagaacctct gccaccgtca ccagctattc attaacttcc gggacctggg ttggcacaag tggatcattg cccccaaggg gttcatggca aattactgcc atggagagtg tcccttctca ctgaccatct ctctcaacag ctccaattat gctttcatgc aagccctgat gcatgccgtt gacccagaga tcccccaggc tgtgtgtatc cccaccaagc tgtctcccat ttccatgctc taccaggaca ataatgacaa tgtcattcta cgacattatg aagacatggt agtcgatgaa tgtgggtgtg ggtag. It is sometimes possible for the material contained within the vial of "GDF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.