GDAP2 cdna clone
GDAP2 cDNA Clone
Gene Names
GDAP2; MACROD3
Synonyms
GDAP2; GDAP2 cDNA Clone; GDAP2 cdna clone
Sequence
atggatcccttaggtgcaccttcccagtttgtggatgtggatacactaccaagctggggtgactcatgccaagatgaattaaattcctctgatactacagctgaaatatttcaggaagacactgttcgatcaccttttctttataataaggacgtcaatggaaaagtggttctttggaaaggagatgtggcattactgaactgtacagccattgtgaataccagcaatgaaagtctcacagataagaatcctgtgtcagaaagtatcttcatgcttgcagggcctgatttgaaggaagatctccagaaacttaaagggtgccgaacaggtgaagcaaaattgacaaaaggattcaatctagctgcccggttcatcattcacacagtgggacctaaatataaaagccgctatcgcacagcagctgagagttccctttatagctgctacagaaacgtacttcaactagcaaaagagcagtcaatgtcttctgttggcttctgtgtcatcaattctgcaaaacgtggttatcctttagaggatgcaacacacatagcacttcgcactgtaagaagattcctagagattcatggggaaaccattgaaaaagtagtatttgctgtctctgatcttgaagagggtacttaccaaaagctgctacctctctacttcccaaggtcattaaaagaggagaatcgatcattgccctacctacctgcagatattggaaatgcagaaggggagcctgtggtacctgaacgacagattagaataagtgagaaacctggtgctccagaagataaccaagaagaggaggatgaaggcttgggagttgatctctctttcattggctctcatgcttttgctcgaatggaaggagatattgacaagcaaagaaaactgatccttcagggacaattatcagaggcagctctgcagaagcagcatcaaagaaattataatcgctggttatgtcaagcaagatctgaggatctgtctgatattgcttctctaaaagccttataccaaacaggtgttgataactgtggtcgaacagtgatggtggtagttggaagaaacattcctgtaacattaatagatatggacaaggctctcttatatttcattcatgtaatggatcacattgctgtgaaggagtatgtattagtgtattttcacaccctgaccagcgaatacaatcacctggactccgacttcctgaagaaactctacgatgttgttgatgtcaagtacaagaggaatttgaaggctgtttattttgtacatcccacatttcgttcaaaggtgtcaacatggttttttaccaccttttctgtctcaggactgaaggacaaaatccaccatgtggacagcctccaccagctgttttctgccatatcaccagaacagattgactttcctccttttgtccttgaatatgatgccagggtaagaagtaccagaagttctccctcacctggtatggtatattaa
Sequence Length
1491
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
56,049 Da
NCBI Official Full Name
Homo sapiens ganglioside induced differentiation associated protein 2, mRNA
NCBI Official Synonym Full Names
ganglioside induced differentiation associated protein 2
NCBI Official Symbol
GDAP2
NCBI Official Synonym Symbols
MACROD3
NCBI Protein Information
ganglioside-induced differentiation-associated protein 2
UniProt Protein Name
Ganglioside-induced differentiation-associated protein 2
Protein Family
UniProt Gene Name
GDAP2
UniProt Entry Name
GDAP2_HUMAN
Uniprot Description
GDAP2: Belongs to the GDAP2 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 1p12
Cellular Component: lysosomal membrane
Molecular Function: protein binding
Research Articles on GDAP2
Similar Products
Product Notes
The GDAP2 gdap2 (Catalog #AAA1266666) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatccct taggtgcacc ttcccagttt gtggatgtgg atacactacc aagctggggt gactcatgcc aagatgaatt aaattcctct gatactacag ctgaaatatt tcaggaagac actgttcgat caccttttct ttataataag gacgtcaatg gaaaagtggt tctttggaaa ggagatgtgg cattactgaa ctgtacagcc attgtgaata ccagcaatga aagtctcaca gataagaatc ctgtgtcaga aagtatcttc atgcttgcag ggcctgattt gaaggaagat ctccagaaac ttaaagggtg ccgaacaggt gaagcaaaat tgacaaaagg attcaatcta gctgcccggt tcatcattca cacagtggga cctaaatata aaagccgcta tcgcacagca gctgagagtt ccctttatag ctgctacaga aacgtacttc aactagcaaa agagcagtca atgtcttctg ttggcttctg tgtcatcaat tctgcaaaac gtggttatcc tttagaggat gcaacacaca tagcacttcg cactgtaaga agattcctag agattcatgg ggaaaccatt gaaaaagtag tatttgctgt ctctgatctt gaagagggta cttaccaaaa gctgctacct ctctacttcc caaggtcatt aaaagaggag aatcgatcat tgccctacct acctgcagat attggaaatg cagaagggga gcctgtggta cctgaacgac agattagaat aagtgagaaa cctggtgctc cagaagataa ccaagaagag gaggatgaag gcttgggagt tgatctctct ttcattggct ctcatgcttt tgctcgaatg gaaggagata ttgacaagca aagaaaactg atccttcagg gacaattatc agaggcagct ctgcagaagc agcatcaaag aaattataat cgctggttat gtcaagcaag atctgaggat ctgtctgata ttgcttctct aaaagcctta taccaaacag gtgttgataa ctgtggtcga acagtgatgg tggtagttgg aagaaacatt cctgtaacat taatagatat ggacaaggct ctcttatatt tcattcatgt aatggatcac attgctgtga aggagtatgt attagtgtat tttcacaccc tgaccagcga atacaatcac ctggactccg acttcctgaa gaaactctac gatgttgttg atgtcaagta caagaggaat ttgaaggctg tttattttgt acatcccaca tttcgttcaa aggtgtcaac atggtttttt accacctttt ctgtctcagg actgaaggac aaaatccacc atgtggacag cctccaccag ctgttttctg ccatatcacc agaacagatt gactttcctc cttttgtcct tgaatatgat gccagggtaa gaagtaccag aagttctccc tcacctggta tggtatatta a. It is sometimes possible for the material contained within the vial of "GDAP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
