Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GCNT2 cdna clone

GCNT2 cDNA Clone

Gene Names
GCNT2; II; CCAT; IGNT; ULG3; GCNT5; GCNT2C; NACGT1; NAGCT1; CTRCT13; bA421M1.1; bA360O19.2
Synonyms
GCNT2; GCNT2 cDNA Clone; GCNT2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacttttggaggtactgcttttttgctttcactctgctcagcgtggtcatttttgtgagattttacagtagccaattgagcccgccaaaaagttatgagaagctgaacagttccagtgaaaggtattttaggaaaactgcctgtaatcacgccttagagaaaatgccagtctttttgtgggaaaatatattaccatcacctttgcgaagtgtcccttgcaaggattacctgacccagaatcactacatcacaagtcccctgtcggaagaagaggctgcattccctttggcctatgtcatggtcatccataaggactttgacacctttgaaaggctctttagggctatctatatgccccaaaatgtctactgtgttcacgtggatgagaaagccccagctgagtataaggaatctgtgaggcagttactgagttgcttccaaaatgctttcattgcttcaaagacagagtctgtggtttatgcaggcatttccagactccaggctgacctgaactgtctgaaagaccttgtcgcctctgaggttccctggaagtacgtcatcaacacctgtggacaagacttccccctgaaaaccaaccgggagatagttcagcatctgaaaggatttaaagggaaaaatatcaccccaggggtgctgcctcctgaccatgcaattaagcgaactaaatatgtccaccaagagcatacagataaaggtggcttttttgtgaaaaatactaatattttgaaaacttcacctccacatcagctgaccatctactttggcactgcctatgtggcgcttaccagagagtttgtcgactttgttctgcgtgaccaaagggccattgatctactacaatggtcaaaagatacctatagtcctgatgagcatttctgggtgacacttaatagggtttcaggtgttcctggctctatgccaaatgcatcctggactggaaacctcagagctataaagtggagtgacatggaagacagacacggaggctgccacggccactatgtacatggtatttgtatctatggaaacggagacttaaagtggctggttaattcaccaagcctgtttgctaacaagtttgagcttaatacctacccccttactgtggaatgcctagaactgaggcatcgcgaaagaaccctcaatcagagtgaaactgcgatacaacccagctggtatttttga
Sequence Length
1209
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,531 Da
NCBI Official Full Name
Homo sapiens glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group), mRNA
NCBI Official Synonym Full Names
glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)
NCBI Official Symbol
GCNT2
NCBI Official Synonym Symbols
II; CCAT; IGNT; ULG3; GCNT5; GCNT2C; NACGT1; NAGCT1; CTRCT13; bA421M1.1; bA360O19.2
NCBI Protein Information
N-acetyllactosaminide beta-1,6-N-acetylglucosaminyl-transferase
UniProt Protein Name
N-acetyllactosaminide beta-1,6-N-acetylglucosaminyl-transferase
UniProt Gene Name
GCNT2
UniProt Synonym Gene Names
GCNT5; II; NACGT1; N-acetylglucosaminyltransferase
UniProt Entry Name
GNT2A_HUMAN

NCBI Description

This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

GCNT2: Branching enzyme that converts linear into branched poly-N-acetyllactosaminoglycans. Introduces the blood group I antigen during embryonic development. It is closely associated with the development and maturation of erythroid cells. The expression of the blood group I antigen in erythrocytes is determined by isoform C. Belongs to the glycosyltransferase 14 family. 3 isoforms of the human protein are produced by alternative splicing

Protein type: EC 2.4.1.150; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p24.2

Cellular Component: membrane

Molecular Function: N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity

Biological Process: glycosaminoglycan biosynthetic process; multicellular organismal development; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of heterotypic cell-cell adhesion; positive regulation of protein kinase B signaling cascade; protein amino acid glycosylation; transforming growth factor beta receptor signaling pathway

Disease: Blood Group, I System

Research Articles on GCNT2

Similar Products

Product Notes

The GCNT2 gcnt2 (Catalog #AAA1266035) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactttt ggaggtactg cttttttgct ttcactctgc tcagcgtggt catttttgtg agattttaca gtagccaatt gagcccgcca aaaagttatg agaagctgaa cagttccagt gaaaggtatt ttaggaaaac tgcctgtaat cacgccttag agaaaatgcc agtctttttg tgggaaaata tattaccatc acctttgcga agtgtccctt gcaaggatta cctgacccag aatcactaca tcacaagtcc cctgtcggaa gaagaggctg cattcccttt ggcctatgtc atggtcatcc ataaggactt tgacaccttt gaaaggctct ttagggctat ctatatgccc caaaatgtct actgtgttca cgtggatgag aaagccccag ctgagtataa ggaatctgtg aggcagttac tgagttgctt ccaaaatgct ttcattgctt caaagacaga gtctgtggtt tatgcaggca tttccagact ccaggctgac ctgaactgtc tgaaagacct tgtcgcctct gaggttccct ggaagtacgt catcaacacc tgtggacaag acttccccct gaaaaccaac cgggagatag ttcagcatct gaaaggattt aaagggaaaa atatcacccc aggggtgctg cctcctgacc atgcaattaa gcgaactaaa tatgtccacc aagagcatac agataaaggt ggcttttttg tgaaaaatac taatattttg aaaacttcac ctccacatca gctgaccatc tactttggca ctgcctatgt ggcgcttacc agagagtttg tcgactttgt tctgcgtgac caaagggcca ttgatctact acaatggtca aaagatacct atagtcctga tgagcatttc tgggtgacac ttaatagggt ttcaggtgtt cctggctcta tgccaaatgc atcctggact ggaaacctca gagctataaa gtggagtgac atggaagaca gacacggagg ctgccacggc cactatgtac atggtatttg tatctatgga aacggagact taaagtggct ggttaattca ccaagcctgt ttgctaacaa gtttgagctt aatacctacc cccttactgt ggaatgccta gaactgaggc atcgcgaaag aaccctcaat cagagtgaaa ctgcgataca acccagctgg tatttttga. It is sometimes possible for the material contained within the vial of "GCNT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.