GBP2 cdna clone
GBP2 cDNA Clone
Synonyms
GBP2; GBP2 cDNA Clone; GBP2 cdna clone
Sequence
atggctccagagatcaacttgccgggcccaatgagcctcattgataacactaaagggcagctggtggtgaatccagaagctctgaagatcctatctgcaattacgcagcctgtggtggtggtggcgattgtgggcctctatcgcacaggcaaatcctacctgatgaacaagctggctgggaagaaaaacggcttctctctaggctccacagtgaagtctcacaccaagggaatctggatgtggtgtgtgcctcatcccaagaagccagaacacaccctagttctgctcgacactgagggcctgggagatatagagaagggtgacaatgagaatgactcctggatctttgccttggccatcctcctgagcagcaccttcgtgtacaatagcatgggaaccatcaaccagcaggccatggaccaacttcactatgtgacagagctgacagatcgaatcaaggcaaactcctcacctggtaacaattctgtagacgactcagctgactttgtgagcttttttccagcatttgtgtggactctcagagatttcaccctggaactggaagtagatggagaacccatcactgctgatgactacttggagctttcgctaaagctaagaaaaggtactgataagaaaagtaaaagctttaatgatcctcggttgtgcatccgaaagttcttccccaagaggaagtgcttcgtcttcgattggcccgctcctaagaagtaccttgctcacctagagcagctaaaggaggaagagctgaaccctgatttcatagaacaagttgcagaattttgttcctacatcctcagccattccaatgtcaagactctttcaggtggcattccagtcaatgggcctcgtctagagagcctggtgctgacctacgtcaatgccatcagcagtggggatctaccctgcagggagaacgcagtcctggccttggcccagatagagaactcagccgcagtggaaaaggctattgcccactatgaacagcagatgggccagaaggtgcagctgcccacggaaaccctccaggagctgctggacctgcacagggacagtgagagagaggccattgaagtcttcatgaagaactctttcaaggatgtggaccaaatgttccagaggaaattaggggcccagttggaagcaaggcgagatgacttttgtaagcagaattccaaagcatcatcagattgttgcatggctttacttcaggatatatttggccctttagaagaagatgtcaagcagggaacattttctaaaccaggaggttaccgtctctttactcagaagctgcaggagctgaagaataagtactaccaggtgccaaggaaggggatacaggccaaagaggtgctgaaaaaatatttggagtccaaggaggatgtggctgatgcacttctacagactgatcagtcactctcagaaaaggaaaaagcgattgaagtggaacgtataaaggctgaatctgcagaagctgcaaagaaaatgttggaggaaatacaaaagaagaatgaggagatgatggaacagaaagagaagagttatcaggaacatgtgaaacaattgactgagaagatggagagggacagggcccagttaatggcagagcaagagaagaccctcgctcttaaacttcaggaacaggaacgccttctcaaggagggattcgagaatgagagcaagagacttcaaaaagacatatgggatatccagatgagaagcaaatcattggagccaatatgtaacatactctaa
Sequence Length
1776
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
67,209 Da
NCBI Official Full Name
Homo sapiens guanylate binding protein 2, interferon-inducible, mRNA
NCBI Official Synonym Full Names
guanylate binding protein 2
NCBI Official Symbol
GBP2
NCBI Protein Information
guanylate-binding protein 2
UniProt Protein Name
Guanylate-binding protein 2
Protein Family
UniProt Gene Name
GBP2
UniProt Synonym Gene Names
GBP-2; HuGBP-2
UniProt Entry Name
GBP2_HUMAN
NCBI Description
This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. [provided by RefSeq, Jul 2013]
Uniprot Description
GBP2: a member of the family of large GTP-binding proteins (GBPs) that is inducible by interferon. Possesses a high GTP hydrolysis activity. GBPs are the most abundant cellular proteins expressed in response to interferon-gamma (IFN-gamma). IFN-gamma, tumor necrosis factor-alpha (TNF-alpha), and interleukin-1beta (IL-1beta) strongly induce the expression of GBP-1, -2, and -3.
Protein type: Hydrolase; Vesicle
Chromosomal Location of Human Ortholog: 1p22.2
Cellular Component: cytosol
Molecular Function: protein binding
Biological Process: immune response
Research Articles on GBP2
Similar Products
Product Notes
The GBP2 gbp2 (Catalog #AAA1269072) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccag agatcaactt gccgggccca atgagcctca ttgataacac taaagggcag ctggtggtga atccagaagc tctgaagatc ctatctgcaa ttacgcagcc tgtggtggtg gtggcgattg tgggcctcta tcgcacaggc aaatcctacc tgatgaacaa gctggctggg aagaaaaacg gcttctctct aggctccaca gtgaagtctc acaccaaggg aatctggatg tggtgtgtgc ctcatcccaa gaagccagaa cacaccctag ttctgctcga cactgagggc ctgggagata tagagaaggg tgacaatgag aatgactcct ggatctttgc cttggccatc ctcctgagca gcaccttcgt gtacaatagc atgggaacca tcaaccagca ggccatggac caacttcact atgtgacaga gctgacagat cgaatcaagg caaactcctc acctggtaac aattctgtag acgactcagc tgactttgtg agcttttttc cagcatttgt gtggactctc agagatttca ccctggaact ggaagtagat ggagaaccca tcactgctga tgactacttg gagctttcgc taaagctaag aaaaggtact gataagaaaa gtaaaagctt taatgatcct cggttgtgca tccgaaagtt cttccccaag aggaagtgct tcgtcttcga ttggcccgct cctaagaagt accttgctca cctagagcag ctaaaggagg aagagctgaa ccctgatttc atagaacaag ttgcagaatt ttgttcctac atcctcagcc attccaatgt caagactctt tcaggtggca ttccagtcaa tgggcctcgt ctagagagcc tggtgctgac ctacgtcaat gccatcagca gtggggatct accctgcagg gagaacgcag tcctggcctt ggcccagata gagaactcag ccgcagtgga aaaggctatt gcccactatg aacagcagat gggccagaag gtgcagctgc ccacggaaac cctccaggag ctgctggacc tgcacaggga cagtgagaga gaggccattg aagtcttcat gaagaactct ttcaaggatg tggaccaaat gttccagagg aaattagggg cccagttgga agcaaggcga gatgactttt gtaagcagaa ttccaaagca tcatcagatt gttgcatggc tttacttcag gatatatttg gccctttaga agaagatgtc aagcagggaa cattttctaa accaggaggt taccgtctct ttactcagaa gctgcaggag ctgaagaata agtactacca ggtgccaagg aaggggatac aggccaaaga ggtgctgaaa aaatatttgg agtccaagga ggatgtggct gatgcacttc tacagactga tcagtcactc tcagaaaagg aaaaagcgat tgaagtggaa cgtataaagg ctgaatctgc agaagctgca aagaaaatgt tggaggaaat acaaaagaag aatgaggaga tgatggaaca gaaagagaag agttatcagg aacatgtgaa acaattgact gagaagatgg agagggacag ggcccagtta atggcagagc aagagaagac cctcgctctt aaacttcagg aacaggaacg ccttctcaag gagggattcg agaatgagag caagagactt caaaaagaca tatgggatat ccagatgaga agcaaatcat tggagccaat atgtaacata ctctaa. It is sometimes possible for the material contained within the vial of "GBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
