GATAD2B cdna clone
GATAD2B cDNA Clone
Synonyms
GATAD2B; GATAD2B cDNA Clone; GATAD2B cdna clone
Sequence
atggatagaatgacagaagatgctcttcgcttgaatctgttgaagcggagcttggacccagcagatgagcgagatgatgtcctggcaaagcgactcaaaatggaggggcatgaggccatggaacgtctgaaaatgttggcattgctcaaaaggaaggatttggcaaatcttgaggtgccacatgagttacccaccaaacaggatggcagtggtgtcaagggctatgaagaaaaacttaacgggaatctcaggcctcatggagacaacaggactgctggaaggccaggcaaagaaaacatcaatgatgagcctgtggatatgagtgctagacggagtgagccagagcgaggaaggctaactccctcaccagacatcattgttttgtctgacaatgaggcttccagtccccgttccagttccagaatggaagaaagactcaaagcagccaacttagagatgtttaaggggaaaggcattgaggagcggcagcagcttatcaagcagctgagggatgagctacgattggaagaagcccgactggtcctgttaaagaaactgagacagagtcagctacagaaagagaatgtggtccagaagactccagttgtacagaatgcagcatctattgttcagccatctcctgcccatgtgggacagcagggcctatctaagcttccctctcggcctggggcccaaggggttgaacctcaaaatttgagaacattacagggtcacagtgtcatccgttcagctaccaataccacccttccacacatgttgatgtctcaacgtgttattgcaccaaacccagcccagctacagggtcagcggggcccgcctaagcctggccttgtacgcaccacaacacccaacatgaatcccgccatcaattatcaaccgcagtcaagttcttctgttccatgtcagcgtacaacatcctctgccatctatatgaaccttgcttctcatatccagccagggacggtgaacagagtgtcctcgccacttcctagccccagcgccatgactgatgctgccaactcacaggctgcagccaaattggctcttcgcaaacagctggaaaagacactcctggagatcccaccccctaaacctcctgctcccttacttcatttcttgcctagtgcagccaatagcgagttcatctacatggtaggcttggaagaagtcgtacagagtgtcattgacagccaaggcaaaagctgtgcctcacttctgcgggttgaaccctttgtatgtgcccagtgccgcacagatttcacccctcactggaagcaagaaaagaatggtaagattctatgtgagcagtgtatgacctccaaccagaaaaaggctctaaaagctgaacacaccaaccggctgaaaaatgcatttgtgaaagccctacagcaggaacaggaaattgaacagcgattacagcagcaggcagccctctcccccactacggctccagctgtgtccagtgtcagtaaacaagagaccatcatgagacatcatacgcttcggcaggctccacagccccagagcagcctccagcgtggcatacccacatctgcccgctccatgctttcaaactttgcacaggcaccccagttgtctgtgccaggtggcctccttggtatgccaggtgtcaacattgcatacttgaatactggcatcggaggacacaaaggccccagtttggcagaccgacagcgtgaataccttttagacatgatccctccccggtctatatcgcagtccatcagtggacagaaataa
Sequence Length
1782
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
65,261 Da
NCBI Official Full Name
Homo sapiens GATA zinc finger domain containing 2B, mRNA
UniProt Protein Name
Transcriptional repressor p66-beta
Protein Family
UniProt Gene Name
GATAD2B
UniProt Synonym Gene Names
KIAA1150
UniProt Entry Name
P66B_HUMAN
Uniprot Description
GATAD2B: a transcriptional repressor belonging to the MeCP1 histone deacetylase complex. The MeCP1 complex represses transcription through preferential binding, remodeling, and deacetylating methylated nucleosomes.
Protein type: Transcription factor
Chromosomal Location of Human Ortholog: 1q21.3
Cellular Component: nuclear chromatin; nucleoplasm; NuRD complex; protein complex
Molecular Function: nucleosomal DNA binding; protein binding
Biological Process: ATP-dependent chromatin remodeling; DNA methylation; negative regulation of transcription from RNA polymerase II promoter
Disease: Mental Retardation, Autosomal Dominant 18
Similar Products
Product Notes
The GATAD2B gatad2b (Catalog #AAA1266108) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatagaa tgacagaaga tgctcttcgc ttgaatctgt tgaagcggag cttggaccca gcagatgagc gagatgatgt cctggcaaag cgactcaaaa tggaggggca tgaggccatg gaacgtctga aaatgttggc attgctcaaa aggaaggatt tggcaaatct tgaggtgcca catgagttac ccaccaaaca ggatggcagt ggtgtcaagg gctatgaaga aaaacttaac gggaatctca ggcctcatgg agacaacagg actgctggaa ggccaggcaa agaaaacatc aatgatgagc ctgtggatat gagtgctaga cggagtgagc cagagcgagg aaggctaact ccctcaccag acatcattgt tttgtctgac aatgaggctt ccagtccccg ttccagttcc agaatggaag aaagactcaa agcagccaac ttagagatgt ttaaggggaa aggcattgag gagcggcagc agcttatcaa gcagctgagg gatgagctac gattggaaga agcccgactg gtcctgttaa agaaactgag acagagtcag ctacagaaag agaatgtggt ccagaagact ccagttgtac agaatgcagc atctattgtt cagccatctc ctgcccatgt gggacagcag ggcctatcta agcttccctc tcggcctggg gcccaagggg ttgaacctca aaatttgaga acattacagg gtcacagtgt catccgttca gctaccaata ccacccttcc acacatgttg atgtctcaac gtgttattgc accaaaccca gcccagctac agggtcagcg gggcccgcct aagcctggcc ttgtacgcac cacaacaccc aacatgaatc ccgccatcaa ttatcaaccg cagtcaagtt cttctgttcc atgtcagcgt acaacatcct ctgccatcta tatgaacctt gcttctcata tccagccagg gacggtgaac agagtgtcct cgccacttcc tagccccagc gccatgactg atgctgccaa ctcacaggct gcagccaaat tggctcttcg caaacagctg gaaaagacac tcctggagat cccaccccct aaacctcctg ctcccttact tcatttcttg cctagtgcag ccaatagcga gttcatctac atggtaggct tggaagaagt cgtacagagt gtcattgaca gccaaggcaa aagctgtgcc tcacttctgc gggttgaacc ctttgtatgt gcccagtgcc gcacagattt cacccctcac tggaagcaag aaaagaatgg taagattcta tgtgagcagt gtatgacctc caaccagaaa aaggctctaa aagctgaaca caccaaccgg ctgaaaaatg catttgtgaa agccctacag caggaacagg aaattgaaca gcgattacag cagcaggcag ccctctcccc cactacggct ccagctgtgt ccagtgtcag taaacaagag accatcatga gacatcatac gcttcggcag gctccacagc cccagagcag cctccagcgt ggcataccca catctgcccg ctccatgctt tcaaactttg cacaggcacc ccagttgtct gtgccaggtg gcctccttgg tatgccaggt gtcaacattg catacttgaa tactggcatc ggaggacaca aaggccccag tttggcagac cgacagcgtg aatacctttt agacatgatc cctccccggt ctatatcgca gtccatcagt ggacagaaat aa. It is sometimes possible for the material contained within the vial of "GATAD2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
