Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GALM cdna clone

GALM cDNA Clone

Gene Names
GALM; GLAT; IBD1; BLOCK25; HEL-S-63p
Synonyms
GALM; GALM cDNA Clone; GALM cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcggtgaccagggccgtgtttggagagctgccctcgggaggagggacagtggagaagttccagctgcagtcagacctcttgagagtggacatcatctcctggggctgcacgatcacagccctagaggtcaaagacaggcaggggagagcctcggacgtggtgcttggcttcgccgagttggaaggatacctccaaaagcagccatactttggagcagttattgggagggtggccaaccgaatcgccaaaggaaccttcaaggtggatgggaaggagtatcacctggccattaacaaggaacccaacagtctgcatggaggagtcagagggtttgataaagtgctctggacccctcgggtgctgtcaaatggcgtccagttctcgcgcatcagtccagatggtgaagaaggctaccccggagagttaaaagtctgggtgacatacaccctggatggcggagagctcatagtcaactacagagcacaagccagtcaggccacaccagtcaacctgaccaaccattcttacttcaacctggcaggccaggcttccccaaatataaatgaccatgaagtcaccatagaagcggatacttatttgcctgtggatgaaaccctgattcctacaggagaagttgccccagtgcaaggcactgcattcgacctgagaaagccagtggagcttggaaaacacctgcaggacttccatctcaatggttttgaccacaatttctgtctgaagggatctaaagaaaagcatttttgtgcaagggtgcatcatgctgcaagcgggcgggtactagaagtatacaccacccagcccggggtccagttttacacgggcaacttcctggatggcacattaaagggcaagaatggagctgtctatcccaagcactccggtttctgcctggagactcagaactggcctgatgcagtcaatcagccccgcttccctcctgtgctgctgaggcctggtgaggagtatgaccacaccacctggttcaagttttctgtggcttaa
Sequence Length
1029
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,766 Da
NCBI Official Full Name
Homo sapiens galactose mutarotase (aldose 1-epimerase), mRNA
NCBI Official Synonym Full Names
galactose mutarotase
NCBI Official Symbol
GALM
NCBI Official Synonym Symbols
GLAT; IBD1; BLOCK25; HEL-S-63p
NCBI Protein Information
aldose 1-epimerase
UniProt Protein Name
Aldose 1-epimerase
Protein Family
UniProt Gene Name
GALM
UniProt Entry Name
GALM_HUMAN

NCBI Description

This gene encodes an enzyme that catalyzes the epimerization of hexose sugars such as glucose and galactose. The encoded protein is expressed in the cytoplasm and has a preference for galactose. The encoded protein may be required for normal galactose metabolism by maintaining the equilibrium of alpha and beta anomers of galactose.[provided by RefSeq, Mar 2009]

Uniprot Description

GALM: Mutarotase converts alpha-aldose to the beta-anomer. It is active on D-glucose, L-arabinose, D-xylose, D-galactose, maltose and lactose. Belongs to the aldose epimerase family.

Protein type: EC 5.1.3.3; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Isomerase

Chromosomal Location of Human Ortholog: 2p22.1

Molecular Function: aldose 1-epimerase activity

Biological Process: galactose metabolic process; glucose metabolic process

Research Articles on GALM

Similar Products

Product Notes

The GALM galm (Catalog #AAA1273104) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcgg tgaccagggc cgtgtttgga gagctgccct cgggaggagg gacagtggag aagttccagc tgcagtcaga cctcttgaga gtggacatca tctcctgggg ctgcacgatc acagccctag aggtcaaaga caggcagggg agagcctcgg acgtggtgct tggcttcgcc gagttggaag gatacctcca aaagcagcca tactttggag cagttattgg gagggtggcc aaccgaatcg ccaaaggaac cttcaaggtg gatgggaagg agtatcacct ggccattaac aaggaaccca acagtctgca tggaggagtc agagggtttg ataaagtgct ctggacccct cgggtgctgt caaatggcgt ccagttctcg cgcatcagtc cagatggtga agaaggctac cccggagagt taaaagtctg ggtgacatac accctggatg gcggagagct catagtcaac tacagagcac aagccagtca ggccacacca gtcaacctga ccaaccattc ttacttcaac ctggcaggcc aggcttcccc aaatataaat gaccatgaag tcaccataga agcggatact tatttgcctg tggatgaaac cctgattcct acaggagaag ttgccccagt gcaaggcact gcattcgacc tgagaaagcc agtggagctt ggaaaacacc tgcaggactt ccatctcaat ggttttgacc acaatttctg tctgaaggga tctaaagaaa agcatttttg tgcaagggtg catcatgctg caagcgggcg ggtactagaa gtatacacca cccagcccgg ggtccagttt tacacgggca acttcctgga tggcacatta aagggcaaga atggagctgt ctatcccaag cactccggtt tctgcctgga gactcagaac tggcctgatg cagtcaatca gccccgcttc cctcctgtgc tgctgaggcc tggtgaggag tatgaccaca ccacctggtt caagttttct gtggcttaa. It is sometimes possible for the material contained within the vial of "GALM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.