Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GALE cdna clone

GALE cDNA Clone

Gene Names
GALE; SDR1E1
Synonyms
GALE; GALE cDNA Clone; GALE cdna clone
Ordering
For Research Use Only!
Sequence
atggcagagaaggtgctggtaacaggtggggctggctacattggcagccacacggtgctggagctgctggaggctggctacttgcctgtggtcatcgataacttccataatgccttccgtggagggggctccctgcctgagagcctgcggcgggtccaggagctgacaggccgctctgtggagtttgaggagatggacattttggaccagggagccctacagcgtctcttcaaaaagtacagctttatggcggtcatccactttgcggggctcaaggccgtgggcgagtcggtgcagaagcctctggattattacagagttaacctgaccgggaccatccagcttctggagatcatgaaggcccacggggtgaagaacctggtgttcagcagctcagccactgtgtacgggaacccccagtacctgccccttgatgaggcccaccccacgggtggttgtaccaacccttacggcaagtccaagttcttcatcgaggaaatgatccgggacctgtgccaggcagacaagacttggaacgcagtgctgctgcgctatttcaaccccacaggtgcccatgcctctggctgcattggtgaggatccccagggcatacccaacaacctcatgccttatgtctcccaggtggcgatcgggcgacgggaggccctgaatgtctttggcaatgactatgacacagaggatggcacaggtgtccgggattacatccatgtcgtggatctggccaagggccacattgcagccttaaggaagctgaaagaacagtgtggctgccggatctacaacctgggcacgggcacaggctattcagtgctgcagatggtccaggctatggagaaggcctctgggaagaagatcccgtacaaggtggtggcacggcgggaaggtgatgtggcagcctgttacgccaaccccagcctggcccaagaggagctggggtggacagcagccttagggctggacaggatgtgtgaggatctctggcgctggcagaagcagaatccttcaggctttggcacgcaagcctga
Sequence Length
1047
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,180 Da
NCBI Official Full Name
Homo sapiens UDP-galactose-4-epimerase, mRNA
NCBI Official Synonym Full Names
UDP-galactose-4-epimerase
NCBI Official Symbol
GALE
NCBI Official Synonym Symbols
SDR1E1
NCBI Protein Information
UDP-glucose 4-epimerase
UniProt Protein Name
UDP-glucose 4-epimerase
Protein Family
UniProt Gene Name
GALE
UniProt Synonym Gene Names
UDP-GlcNAc 4-epimerase
UniProt Entry Name
GALE_HUMAN

NCBI Description

This gene encodes UDP-galactose-4-epimerase which catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose, and the epimerization of UDP-N-acetylglucosamine to UDP-N-acetylgalactosamine. The bifunctional nature of the enzyme has the important metabolic consequence that mutant cells (or individuals) are dependent not only on exogenous galactose, but also on exogenous N-acetylgalactosamine as a necessary precursor for the synthesis of glycoproteins and glycolipids. Mutations in this gene result in epimerase-deficiency galactosemia, also referred to as galactosemia type 3, a disease characterized by liver damage, early-onset cataracts, deafness and mental retardation, with symptoms ranging from mild ('peripheral' form) to severe ('generalized' form). Multiple alternatively spliced transcripts encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

GALE: Catalyzes two distinct but analogous reactions: the epimerization of UDP-glucose to UDP-galactose and the epimerization of UDP-N-acetylglucosamine to UDP-N- acetylgalactosamine. Defects in GALE are the cause of epimerase-deficiency galactosemia (EDG); also known as galactosemia type 3. Clinical features include early-onset cataracts, liver damage, deafness and mental retardation. There are two clinically distinct forms of EDG. (1) A benign, or 'peripheral' form with no detectable GALE activity in red blood cells and characterized by mild symptoms. Some patients may suffer no symptoms beyond raised levels of galactose-1-phosphate in the blood. (2) A much rarer 'generalized' form with undetectable levels of GALE activity in all tissues and resulting in severe features such as restricted growth and mental development. Belongs to the sugar epimerase family.

Protein type: Carbohydrate Metabolism - amino sugar and nucleotide sugar; EC 5.1.3.2; Carbohydrate Metabolism - galactose; Isomerase; EC 5.1.3.7

Chromosomal Location of Human Ortholog: 1p36-p35

Cellular Component: cytosol

Molecular Function: protein homodimerization activity; UDP-glucose 4-epimerase activity

Biological Process: galactose catabolic process

Disease: Galactose Epimerase Deficiency

Research Articles on GALE

Similar Products

Product Notes

The GALE gale (Catalog #AAA1266257) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaga aggtgctggt aacaggtggg gctggctaca ttggcagcca cacggtgctg gagctgctgg aggctggcta cttgcctgtg gtcatcgata acttccataa tgccttccgt ggagggggct ccctgcctga gagcctgcgg cgggtccagg agctgacagg ccgctctgtg gagtttgagg agatggacat tttggaccag ggagccctac agcgtctctt caaaaagtac agctttatgg cggtcatcca ctttgcgggg ctcaaggccg tgggcgagtc ggtgcagaag cctctggatt attacagagt taacctgacc gggaccatcc agcttctgga gatcatgaag gcccacgggg tgaagaacct ggtgttcagc agctcagcca ctgtgtacgg gaacccccag tacctgcccc ttgatgaggc ccaccccacg ggtggttgta ccaaccctta cggcaagtcc aagttcttca tcgaggaaat gatccgggac ctgtgccagg cagacaagac ttggaacgca gtgctgctgc gctatttcaa ccccacaggt gcccatgcct ctggctgcat tggtgaggat ccccagggca tacccaacaa cctcatgcct tatgtctccc aggtggcgat cgggcgacgg gaggccctga atgtctttgg caatgactat gacacagagg atggcacagg tgtccgggat tacatccatg tcgtggatct ggccaagggc cacattgcag ccttaaggaa gctgaaagaa cagtgtggct gccggatcta caacctgggc acgggcacag gctattcagt gctgcagatg gtccaggcta tggagaaggc ctctgggaag aagatcccgt acaaggtggt ggcacggcgg gaaggtgatg tggcagcctg ttacgccaac cccagcctgg cccaagagga gctggggtgg acagcagcct tagggctgga caggatgtgt gaggatctct ggcgctggca gaagcagaat ccttcaggct ttggcacgca agcctga. It is sometimes possible for the material contained within the vial of "GALE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.