G3BP2 cdna clone
G3BP2 cDNA Clone
Synonyms
G3BP2; G3BP2 cDNA Clone; G3BP2 cdna clone
Sequence
atggttatggagaagcccagtccgctgcttgtagggcgggagtttgtgaggcaatattatactttgctgaataaagctccggaatatttacacaggttttatggcaggaattcttcctatgttcatggtggagtagatgctagtggaaagccccaggaagctgtttatggccaaaatgatatacaccacaaagtattatctctgaacttcagtgaatgtcatactaaaattcgtcatgtggatgctcatgcaaccttgagtgatggagtagttgtccaggtcatgggtttgctgtctaacagtggacaaccagaaagaaagtttatgcaaacctttgttctggctcctgaaggatctgttccaaataaattttatgttcacaatgatatgtttcgttatgaagatgaagtgtttggtgattctgagcctgaacttgatgaagaatcagaagatgaagtagaagaggaacaagaagaaagacaaccatctcctgaacctgtgcaagaaaatgctaacagtggttactatgaagctcaccctgtgactaatggcatagaggagcctttggaagaatcctctcatgaacctgaacctgagccagaatctgaaacaaagactgaagagctgaaaccacaagtggaggagaagaacttagaagaactagaggagaaatctactactcctcctccggcagaacctgtttctctgccacaagaaccaccaaagccaagagtcgaagctaaaccagaagttcaatctcagccacctcgtgtgcgtgaacaacgacctagagaacgacctggttttcctcctagaggaccaagaccaggcagaggagatatggaacagaatgactctgacaaccgtagaataattcgctatccagatagtcatcaactttttgttggtaacttgccacatgatattgatgaaaatgagctaaaggaattcttcatgagttttggaaacgttgtggaacttcgcatcaataccaagggtgttgggggaaagcttccaaattttggttttgtggtttttgatgactctgaaccagttcagagaatcttaattgcaaaaccgattatgtttcgaggggaagtacgtttaaatgtggaagagaaaaaaacaagagctgcaagagagcgagaaaccagaggtggtggtgatgatcgcagggatattaggcgcaatgatcgaggtcccggtggtccacgtggaattgtgggtggtggaatgatgcgtgatcgtgatggaagaggacctcctccaaggggtggcatggcacagaaacttggctctggaagaggaaccgggcaaatggagggccgcttcacaggacagcgtcgctga
Sequence Length
1350
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,817 Da
NCBI Official Full Name
Homo sapiens GTPase activating protein (SH3 domain) binding protein 2, mRNA
NCBI Official Synonym Full Names
G3BP stress granule assembly factor 2
NCBI Official Symbol
G3BP2
NCBI Protein Information
ras GTPase-activating protein-binding protein 2
UniProt Protein Name
Ras GTPase-activating protein-binding protein 2
Protein Family
UniProt Gene Name
G3BP2
UniProt Synonym Gene Names
KIAA0660; G3BP-2
UniProt Entry Name
G3BP2_HUMAN
Uniprot Description
G3BP-2: an hnRNA-binding protein and an element of the Ras signal transduction pathway. A DNA-unwinding enzyme which can unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. Binds specifically to the Ras-GTPase-activating protein (GAP120) by associating with its SH3 domain. Interacts with USP10, and may regulate it. Several alternatively spliced transcript variants have been described.
Protein type: Adaptor/scaffold; RNA-binding; Motility/polarity/chemotaxis
Chromosomal Location of Human Ortholog: 4q21.1
Cellular Component: cytoplasm
Molecular Function: protein binding
Research Articles on G3BP2
Similar Products
Product Notes
The G3BP2 g3bp2 (Catalog #AAA1278358) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttatgg agaagcccag tccgctgctt gtagggcggg agtttgtgag gcaatattat actttgctga ataaagctcc ggaatattta cacaggtttt atggcaggaa ttcttcctat gttcatggtg gagtagatgc tagtggaaag ccccaggaag ctgtttatgg ccaaaatgat atacaccaca aagtattatc tctgaacttc agtgaatgtc atactaaaat tcgtcatgtg gatgctcatg caaccttgag tgatggagta gttgtccagg tcatgggttt gctgtctaac agtggacaac cagaaagaaa gtttatgcaa acctttgttc tggctcctga aggatctgtt ccaaataaat tttatgttca caatgatatg tttcgttatg aagatgaagt gtttggtgat tctgagcctg aacttgatga agaatcagaa gatgaagtag aagaggaaca agaagaaaga caaccatctc ctgaacctgt gcaagaaaat gctaacagtg gttactatga agctcaccct gtgactaatg gcatagagga gcctttggaa gaatcctctc atgaacctga acctgagcca gaatctgaaa caaagactga agagctgaaa ccacaagtgg aggagaagaa cttagaagaa ctagaggaga aatctactac tcctcctccg gcagaacctg tttctctgcc acaagaacca ccaaagccaa gagtcgaagc taaaccagaa gttcaatctc agccacctcg tgtgcgtgaa caacgaccta gagaacgacc tggttttcct cctagaggac caagaccagg cagaggagat atggaacaga atgactctga caaccgtaga ataattcgct atccagatag tcatcaactt tttgttggta acttgccaca tgatattgat gaaaatgagc taaaggaatt cttcatgagt tttggaaacg ttgtggaact tcgcatcaat accaagggtg ttgggggaaa gcttccaaat tttggttttg tggtttttga tgactctgaa ccagttcaga gaatcttaat tgcaaaaccg attatgtttc gaggggaagt acgtttaaat gtggaagaga aaaaaacaag agctgcaaga gagcgagaaa ccagaggtgg tggtgatgat cgcagggata ttaggcgcaa tgatcgaggt cccggtggtc cacgtggaat tgtgggtggt ggaatgatgc gtgatcgtga tggaagagga cctcctccaa ggggtggcat ggcacagaaa cttggctctg gaagaggaac cgggcaaatg gagggccgct tcacaggaca gcgtcgctga. It is sometimes possible for the material contained within the vial of "G3BP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
