Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FXYD6 cdna clone

FXYD6 cDNA Clone

Synonyms
FXYD6; FXYD6 cDNA Clone; FXYD6 cdna clone
Ordering
For Research Use Only!
Sequence
atggagttggtgctggtcttcctctgcagcctgctggcccccatggtcctggccagtgcagctgaaaaggagaaggaaatggacccttttcattatgattaccagaccctgaggattgggggactggtgttcgctgtggtcctcttctcggttgggatcctccttatcctaagtcgcaggtgcaagtgcagtttcaatcagaagccccgggccccaggagatgaggaagcccaggtggagaacctcatcaccgccaatgcaacagagccccagaaagcagagaactga
Sequence Length
288
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,769 Da
NCBI Official Full Name
Homo sapiens FXYD domain containing ion transport regulator 6, mRNA
NCBI Official Synonym Full Names
FXYD domain containing ion transport regulator 6
NCBI Official Symbol
FXYD6
NCBI Protein Information
FXYD domain-containing ion transport regulator 6
UniProt Protein Name
FXYD domain-containing ion transport regulator 6
UniProt Gene Name
FXYD6
UniProt Entry Name
FXYD6_HUMAN

NCBI Description

This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes phosphohippolin, which likely affects the activity of Na,K-ATPase. Multiple alternatively spliced transcript variants encoding the same protein have been described. Related pseudogenes have been identified on chromosomes 10 and X. Read-through transcripts have been observed between this locus and the downstream sodium/potassium-transporting ATPase subunit gamma (FXYD2, GeneID 486) locus.[provided by RefSeq, Feb 2011]

Uniprot Description

FXYD6: Genetic variations in FXYD6 are associated with susceptibility to schizophrenia type 2 (SCZD2). A complex, multifactorial psychotic disorder or group of disorders characterized by disturbances in the form and content of thought (e.g. delusions, hallucinations), in mood (e.g. inappropriate affect), in sense of self and relationship to the external world (e.g. loss of ego boundaries, withdrawal), and in behavior (e.g bizarre or apparently purposeless behavior). Although it affects emotions, it is distinguished from mood disorders in which such disturbances are primary. Similarly, there may be mild impairment of cognitive function, and it is distinguished from the dementias in which disturbed cognitive function is considered primary. Some patients manifest schizophrenic as well as bipolar disorder symptoms and are often given the diagnosis of schizoaffective disorder. Belongs to the FXYD family.

Protein type: Channel, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: plasma membrane

Molecular Function: protein binding

Research Articles on FXYD6

Similar Products

Product Notes

The FXYD6 fxyd6 (Catalog #AAA1276018) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagttgg tgctggtctt cctctgcagc ctgctggccc ccatggtcct ggccagtgca gctgaaaagg agaaggaaat ggaccctttt cattatgatt accagaccct gaggattggg ggactggtgt tcgctgtggt cctcttctcg gttgggatcc tccttatcct aagtcgcagg tgcaagtgca gtttcaatca gaagccccgg gccccaggag atgaggaagc ccaggtggag aacctcatca ccgccaatgc aacagagccc cagaaagcag agaactga. It is sometimes possible for the material contained within the vial of "FXYD6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.