Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FXYD5 cdna clone

FXYD5 cDNA Clone

Gene Names
FXYD5; RIC; IWU1; KCT1; OIT2; DYSAD; HSPC113; PRO6241
Synonyms
FXYD5; FXYD5 cDNA Clone; FXYD5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgccctctggtcgcctgtgtcttcttaccatcgttggcctgattctccccaccagaggacagacgttgaaagataccacgtccagttcttcagcagactcaactatcatggacattcaggtcccgacacgagccccagatgcagtctacacagaactccagcccacctctccaaccccaacctggcctgctgatgaaacaccacaaccccagacccagacccagcaactggaaggaacggatgggcctctagtgacagatccagagacacacaagagcaccaaagcagctcatcccactgatgacaccacgacgctctctgagagaccatccccaagcacagacgtccagacagacccccagaccctcaagccatctggttttcatgaggatgaccccttcttctatgatgaacacaccctccggaaacgggggctgttggtcgcagctgtgctgttcatcacaggcatcatcatcctcaccagtggcaagtgcaggcagctgtcccggttatgccggaatcattgcaggtga
Sequence Length
537
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,888 Da
NCBI Official Full Name
Homo sapiens FXYD domain containing ion transport regulator 5, mRNA
NCBI Official Synonym Full Names
FXYD domain containing ion transport regulator 5
NCBI Official Symbol
FXYD5
NCBI Official Synonym Symbols
RIC; IWU1; KCT1; OIT2; DYSAD; HSPC113; PRO6241
NCBI Protein Information
FXYD domain-containing ion transport regulator 5
UniProt Protein Name
FXYD domain-containing ion transport regulator 5
UniProt Gene Name
FXYD5
UniProt Synonym Gene Names
DYSAD; IWU1
UniProt Entry Name
FXYD5_HUMAN

NCBI Description

This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. This gene product, FXYD5, is a glycoprotein that functions in the up-regulation of chemokine production, and it is involved in the reduction of cell adhesion via its ability to down-regulate E-cadherin. It also promotes metastasis, and has been linked to a variety of cancers. Alternative splicing results in multiple transcript variants. [RefSeq curation by Kathleen J. Sweadner, Ph.D., [email protected]., Sep 2009]

Uniprot Description

FXYD5: Involved in down-regulation of E-cadherin which results in reduced cell adhesion. Promotes metastasis. Belongs to the FXYD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion; Membrane protein, integral; Actin-binding

Chromosomal Location of Human Ortholog: 19q13.12

Cellular Component: integral to membrane; integral to plasma membrane

Molecular Function: actin binding; cadherin binding; sodium channel regulator activity

Research Articles on FXYD5

Similar Products

Product Notes

The FXYD5 fxyd5 (Catalog #AAA1278364) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgccct ctggtcgcct gtgtcttctt accatcgttg gcctgattct ccccaccaga ggacagacgt tgaaagatac cacgtccagt tcttcagcag actcaactat catggacatt caggtcccga cacgagcccc agatgcagtc tacacagaac tccagcccac ctctccaacc ccaacctggc ctgctgatga aacaccacaa ccccagaccc agacccagca actggaagga acggatgggc ctctagtgac agatccagag acacacaaga gcaccaaagc agctcatccc actgatgaca ccacgacgct ctctgagaga ccatccccaa gcacagacgt ccagacagac ccccagaccc tcaagccatc tggttttcat gaggatgacc ccttcttcta tgatgaacac accctccgga aacgggggct gttggtcgca gctgtgctgt tcatcacagg catcatcatc ctcaccagtg gcaagtgcag gcagctgtcc cggttatgcc ggaatcattg caggtga. It is sometimes possible for the material contained within the vial of "FXYD5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.