Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FXYD3 cdna clone

FXYD3 cDNA Clone

Gene Names
FXYD3; MAT8; PLML
Synonyms
FXYD3; FXYD3 cDNA Clone; FXYD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagaaggtgaccctgggcctgcttgtgttcctggcaggctttcctgtcctggacgccaatgacctagaagataaaaacagtcctttctactatgactggcacagcctccaggttggcgggctcatctgcgctggggttctgtgcgccatgggcatcatcatcgtcatgagtgcaaaatgcaaatgcaagtttggccagaagtccggtcaccatccaggggagactccacctctcatcaccccaggctcagcccaaagctga
Sequence Length
264
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
6,718 Da
NCBI Official Full Name
Homo sapiens FXYD domain containing ion transport regulator 3, mRNA
NCBI Official Synonym Full Names
FXYD domain containing ion transport regulator 3
NCBI Official Symbol
FXYD3
NCBI Official Synonym Symbols
MAT8; PLML
NCBI Protein Information
FXYD domain-containing ion transport regulator 3
UniProt Protein Name
FXYD domain-containing ion transport regulator 3
UniProt Gene Name
FXYD3
UniProt Synonym Gene Names
MAT8; PLML
UniProt Entry Name
FXYD3_HUMAN

NCBI Description

This gene belongs to a small family of FXYD-domain containing regulators of Na+/K+ ATPases which share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD, and containing 7 invariant and 6 highly conserved amino acids. This gene encodes a cell membrane protein that may regulate the function of ion-pumps and ion-channels. This gene may also play a role in tumor progression. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]

Uniprot Description

FXYD3: Induces a hyperpolarization-activated chloride current when expressed in Xenopus oocytes. May be a modulator capable of activating endogenous oocyte channels. Belongs to the FXYD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.12

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: sodium channel regulator activity

Biological Process: chloride transport

Research Articles on FXYD3

Similar Products

Product Notes

The FXYD3 fxyd3 (Catalog #AAA1267078) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagaagg tgaccctggg cctgcttgtg ttcctggcag gctttcctgt cctggacgcc aatgacctag aagataaaaa cagtcctttc tactatgact ggcacagcct ccaggttggc gggctcatct gcgctggggt tctgtgcgcc atgggcatca tcatcgtcat gagtgcaaaa tgcaaatgca agtttggcca gaagtccggt caccatccag gggagactcc acctctcatc accccaggct cagcccaaag ctga. It is sometimes possible for the material contained within the vial of "FXYD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.