FUK cdna clone
FUK cDNA Clone
Gene Names
FUK; 1110046B12Rik
Synonyms
FUK; FUK cDNA Clone; FUK cdna clone
Sequence
atgggtcgagacttcccctttgatgactgtggcagggctttcacctgcctccccgtggagaaccccgaggcccccgtggaagccttggtctgcaacctggactgcctgctggacatcatgacctatcggctgggcccgggctccccgccaggcgtgtgggtctgcagcaccgacatgctgctgtctgttcctgcaaatcctggtatcagctgggacagcttccggggagccagagtgatcgccctcccagggagcccggcctacgctcagaatcatggcgtctacctaactgacccccagggccttgttttggacatttactaccagggcactgaggcagagattcagcggtgtgtcaggcctgatgggcgggtgccactggtctctggggttgtcttcttctctgtggagactgccgagcgcctcctagccacccacgtgagcccgcccctggatgcctgcacctacctaggcttggactccggagcccggcctgtccagctgtctctgttttttgacattctccactgcatggctgagaacgtgaccagggaggacttcctggtggggaggcccccagagttggggcaaggcgatgcagatgtagcgggttatctgcagagcgcccgggcccagctgtggagggagcttcgcgatcagccccttaccatggcctatgtctccagcggcagctacagctacatgacctcctcagccagtgagttcctgctcagcctcacactccccggggctcctggggcccagattgtgcactcccaggtggaggagcagcagcttctggcggccgggagctctgtggtcagctgcctgctggagggccctgtccagctgggtcctgggagcgtcctgcagcactgccacctgcagggccccattcacataggcgctggctgcttggtgactggcctggatacagcccactccaaggccctgcatggccgggagctgcgtgaccttgtcctgcagggacaccacacgcggctacacggctccccgggccacgccttcaccctcgttggccgtctggacagctgggagagacagggggcaggcacatatctcaacgtgccctggagtgaattcttcaagaggacaggtgttcgagcctgggacctgtgggaccctgagacgctgcccgcagagtactgccttcccagcgcccgcctctttcctgtgctccacccctcgagggagctgggaccccaggacctgctgtggatgctggaccaccaggaggatgggggcgaggccctgcgagcctggcgggcctcctggcgcctgtcctgggagcagctgcagccgtgcctggatcgggctgccacgctggcctctcgccgggacctgttcttccgccaggccctgcataaggcgcggcacgtgctggaggcccggcaggacctcagcctgcgcccgctgatctgggctgctgtccgcgagggctgccccgggcccctgctggccacgctggaccaggttgcagctggggcaggagaccctggtgtggcggcacgggcactggcctgtgtggcggacgtcctgggctgcatggcagagggccgtgggggcttgcggagcgggccagctgccaaccctgagtggatgcggcccttctcatacctggagtgtggagacctggcagcgggcgtggaggcgcttgcccaggagagggacaagtggctaagcaggccagccttgctggtgcgagcggcccgccactatgagggggctggtcagatcctgatccgccaggctgtgatgtcagcccagcactttgtctccacagagcaggtggaactgccgggacctgggcagtgggtggtggctgagtgcccggcccgtgtggatttctctgggggctggagtgacacgccaccccttgcctatgagcttggcggggctgtgctgggcctggctgtgcgagtggacggccgccggcccatcggagccagggcacgccgcatcccggagcctgagctgtggctggcggtggggcctcggcaggatgagatgactgtgaagatagtgtgccggtgcctggctgacctgcgggactactgccagcctcatgccccaggggccctgctgaaggcggccttcatctgtgcagggatcgtgcatgtccactcggaactccagctgagtgagcagctgctccgcaccttcgggggcggctttgagctgcacacctggtctgagctgccccacggctctggcctgggcaccagcagcatcctggcaggcactgccctggctgccttgcagcgagccgcaggccgggtggtgggcacggaagccctgatccacgcagtgctgcacctggagcaggtgctcaccactggaggtggctggcaggaccaagtaggtggcctaatgcctggcatcaaggtggggcgctcccgggctcagctgccactgaaggtggaggtagaagaggtcacggtgcctgagggctttgtccagaagctcaatgaccacctgctcttggtgtacactggcaagacccgcctggctcggaacctgctgcaggatgtgctgaggagctggtatgcccgacttcctgctgtggtgcagaatgcccacagcctggtacggcaaactgaggagtgtgctgaaggcttccgccaaggaagcctgcctctgctgggccagtgcctgacctcgtactgggagcagaagaagctcatggctccaggctgtgagcccctgactgtgcggcgtatgatggatgtcctggccccccacgtgcatggccagagcctggctggggcaggcggtggaggctttctctatctgttgaccaaggagccacagcaaaaggaggccttggaggcggtgctggccaagaccgagggccttgggaattacagcatccacctggttgaagtggacactcagggcctgagcctgaagctgctggggaccgaggcctcaacctgttgccctttcccatga
Sequence Length
2973
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
118,393 Da
NCBI Official Full Name
Homo sapiens fucokinase, mRNA
NCBI Official Synonym Full Names
fucokinase
NCBI Official Symbol
FUK
NCBI Official Synonym Symbols
1110046B12Rik
NCBI Protein Information
L-fucose kinase
UniProt Protein Name
L-fucose kinase
Protein Family
UniProt Gene Name
FUK
UniProt Synonym Gene Names
Fucokinase
UniProt Entry Name
FUK_HUMAN
NCBI Description
The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature of only one has been described to date. [provided by RefSeq, Jul 2008]
Uniprot Description
FUK: Takes part in the salvage pathway for reutilization of fucose from the degradation of oligosaccharides. Belongs to the GHMP kinase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Carbohydrate Metabolism - amino sugar and nucleotide sugar; Carbohydrate Metabolism - fructose and mannose; EC 2.7.1.52; Kinase, other
Chromosomal Location of Human Ortholog: 16q22.1
Cellular Component: cytosol
Molecular Function: fucokinase activity
Similar Products
Product Notes
The FUK fuk (Catalog #AAA1278485) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcgag acttcccctt tgatgactgt ggcagggctt tcacctgcct ccccgtggag aaccccgagg cccccgtgga agccttggtc tgcaacctgg actgcctgct ggacatcatg acctatcggc tgggcccggg ctccccgcca ggcgtgtggg tctgcagcac cgacatgctg ctgtctgttc ctgcaaatcc tggtatcagc tgggacagct tccggggagc cagagtgatc gccctcccag ggagcccggc ctacgctcag aatcatggcg tctacctaac tgacccccag ggccttgttt tggacattta ctaccagggc actgaggcag agattcagcg gtgtgtcagg cctgatgggc gggtgccact ggtctctggg gttgtcttct tctctgtgga gactgccgag cgcctcctag ccacccacgt gagcccgccc ctggatgcct gcacctacct aggcttggac tccggagccc ggcctgtcca gctgtctctg ttttttgaca ttctccactg catggctgag aacgtgacca gggaggactt cctggtgggg aggcccccag agttggggca aggcgatgca gatgtagcgg gttatctgca gagcgcccgg gcccagctgt ggagggagct tcgcgatcag ccccttacca tggcctatgt ctccagcggc agctacagct acatgacctc ctcagccagt gagttcctgc tcagcctcac actccccggg gctcctgggg cccagattgt gcactcccag gtggaggagc agcagcttct ggcggccggg agctctgtgg tcagctgcct gctggagggc cctgtccagc tgggtcctgg gagcgtcctg cagcactgcc acctgcaggg ccccattcac ataggcgctg gctgcttggt gactggcctg gatacagccc actccaaggc cctgcatggc cgggagctgc gtgaccttgt cctgcaggga caccacacgc ggctacacgg ctccccgggc cacgccttca ccctcgttgg ccgtctggac agctgggaga gacagggggc aggcacatat ctcaacgtgc cctggagtga attcttcaag aggacaggtg ttcgagcctg ggacctgtgg gaccctgaga cgctgcccgc agagtactgc cttcccagcg cccgcctctt tcctgtgctc cacccctcga gggagctggg accccaggac ctgctgtgga tgctggacca ccaggaggat gggggcgagg ccctgcgagc ctggcgggcc tcctggcgcc tgtcctggga gcagctgcag ccgtgcctgg atcgggctgc cacgctggcc tctcgccggg acctgttctt ccgccaggcc ctgcataagg cgcggcacgt gctggaggcc cggcaggacc tcagcctgcg cccgctgatc tgggctgctg tccgcgaggg ctgccccggg cccctgctgg ccacgctgga ccaggttgca gctggggcag gagaccctgg tgtggcggca cgggcactgg cctgtgtggc ggacgtcctg ggctgcatgg cagagggccg tgggggcttg cggagcgggc cagctgccaa ccctgagtgg atgcggccct tctcatacct ggagtgtgga gacctggcag cgggcgtgga ggcgcttgcc caggagaggg acaagtggct aagcaggcca gccttgctgg tgcgagcggc ccgccactat gagggggctg gtcagatcct gatccgccag gctgtgatgt cagcccagca ctttgtctcc acagagcagg tggaactgcc gggacctggg cagtgggtgg tggctgagtg cccggcccgt gtggatttct ctgggggctg gagtgacacg ccaccccttg cctatgagct tggcggggct gtgctgggcc tggctgtgcg agtggacggc cgccggccca tcggagccag ggcacgccgc atcccggagc ctgagctgtg gctggcggtg gggcctcggc aggatgagat gactgtgaag atagtgtgcc ggtgcctggc tgacctgcgg gactactgcc agcctcatgc cccaggggcc ctgctgaagg cggccttcat ctgtgcaggg atcgtgcatg tccactcgga actccagctg agtgagcagc tgctccgcac cttcgggggc ggctttgagc tgcacacctg gtctgagctg ccccacggct ctggcctggg caccagcagc atcctggcag gcactgccct ggctgccttg cagcgagccg caggccgggt ggtgggcacg gaagccctga tccacgcagt gctgcacctg gagcaggtgc tcaccactgg aggtggctgg caggaccaag taggtggcct aatgcctggc atcaaggtgg ggcgctcccg ggctcagctg ccactgaagg tggaggtaga agaggtcacg gtgcctgagg gctttgtcca gaagctcaat gaccacctgc tcttggtgta cactggcaag acccgcctgg ctcggaacct gctgcaggat gtgctgagga gctggtatgc ccgacttcct gctgtggtgc agaatgccca cagcctggta cggcaaactg aggagtgtgc tgaaggcttc cgccaaggaa gcctgcctct gctgggccag tgcctgacct cgtactggga gcagaagaag ctcatggctc caggctgtga gcccctgact gtgcggcgta tgatggatgt cctggccccc cacgtgcatg gccagagcct ggctggggca ggcggtggag gctttctcta tctgttgacc aaggagccac agcaaaagga ggccttggag gcggtgctgg ccaagaccga gggccttggg aattacagca tccacctggt tgaagtggac actcagggcc tgagcctgaa gctgctgggg accgaggcct caacctgttg ccctttccca tga. It is sometimes possible for the material contained within the vial of "FUK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
