FUCA2 cdna clone
FUCA2 cDNA Clone
Gene Names
FUCA2; dJ20N2.5
Synonyms
FUCA2; FUCA2 cDNA Clone; FUCA2 cdna clone
Sequence
atgcggccccaggagctccccaggctcgcgttcccgttgctgctgttgctgttgctgctgctgccgccgccgccgtgccctgcccacagcgccacgcgcttcgaccccacctgggagtccctggacgcccgccagctgcccgcgtggtttgaccaggccaagttcggcatcttcatccactggggagtgttttccgtgcccagcttcggtagcgagtggttctggtggtattggcaaaaggaaaagataccgaagtatgtggaatttatgaaagataattaccctcctagtttcaaatatgaagattttggaccactatttacagcaaaattttttaatgccaaccagtgggcagatatttttcaggcctctggtgccaaatacattgtcttaacttccaaacatcatgaaggctttaccttgtgggggtcagaatattcgtggaactggaatgccatagatgaggggcccaagagggacattgtcaaggaacttgaggtagccattaggaacagaactgacctgcgttttggactgtactattccctttttgaatggtttcatccgctcttccttgaggatgaatccagttcattccataagcggcaatttccagtttctaagacattgccagagctctatgagttagtgaacaactatcagcctgaggttctgtggtcggatggtgacggaggagcaccggatcaatactggaacagcacaggcttcttggcctggttatataatgaaagcccagttcggggcacagtagtcaccaatgatcgttggggagctggtagcatctgtaagcatggtggcttctatacctgcagtgatcgttataacccaggacatcttttgccacataaatgggaaaactgcatgacaatagacaaactgtcctggggctataggagggaagctggaatctctgactatcttacaattgaagaattggtgaagcaacttgtagagacagtttcatgtggaggaaatcttttgatgaatattgggcccacactagatggcaccatttctgtagtttttgaggagcgactgaggcaagtggggtcctggctaaaagtcaatggagaagctatttatgaaacctatacctggcgatcccagaatgacactgtcaccccagatgtgtggtacacatccaagcctaaagaaaaattagtctatgccatttttcttaaatggcccacatcaggacagctgttccttggccatcccaaagctattctgggggcaacagaggtgaaactactgggccatggacagccacttaactggatttctttggagcaaaatggcattatggtagaactgccacagctaaccattcatcagatgccgtgtaaatggggctgggctctagccctaactaatgtgatctaa
Sequence Length
1404
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,835 Da
NCBI Official Full Name
Homo sapiens fucosidase, alpha-L- 2, plasma, mRNA
NCBI Official Synonym Full Names
fucosidase, alpha-L- 2, plasma
NCBI Official Symbol
FUCA2
NCBI Official Synonym Symbols
dJ20N2.5
NCBI Protein Information
plasma alpha-L-fucosidase
UniProt Protein Name
Plasma alpha-L-fucosidase
Protein Family
UniProt Gene Name
FUCA2
UniProt Synonym Gene Names
Alpha-L-fucosidase 2
UniProt Entry Name
FUCO2_HUMAN
NCBI Description
This gene encodes a plasma alpha-L-fucosidase, which represents 10-20% of the total cellular fucosidase activity. The protein is a member of the glycosyl hydrolase 29 family, and catalyzes the hydrolysis of the alpha-1,6-linked fucose joined to the reducing-end N-acetylglucosamine of the carbohydrate moieties of glycoproteins. This enzyme is essential for Helicobacter pylori adhesion to human gastric cancer cells. [provided by RefSeq, Aug 2010]
Uniprot Description
FUCA2: Alpha-L-fucosidase is responsible for hydrolyzing the alpha-1,6-linked fucose joined to the reducing-end N- acetylglucosamine of the carbohydrate moieties of glycoproteins. Belongs to the glycosyl hydrolase 29 family.
Protein type: EC 3.2.1.51; Hydrolase; Secreted, signal peptide; Glycan Metabolism - other glycan degradation; Secreted
Chromosomal Location of Human Ortholog: 6q24
Cellular Component: extracellular space
Molecular Function: alpha-L-fucosidase activity; protein binding
Biological Process: fucose metabolic process; glycoside catabolic process; response to bacterium
Research Articles on FUCA2
Similar Products
Product Notes
The FUCA2 fuca2 (Catalog #AAA1277553) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggcccc aggagctccc caggctcgcg ttcccgttgc tgctgttgct gttgctgctg ctgccgccgc cgccgtgccc tgcccacagc gccacgcgct tcgaccccac ctgggagtcc ctggacgccc gccagctgcc cgcgtggttt gaccaggcca agttcggcat cttcatccac tggggagtgt tttccgtgcc cagcttcggt agcgagtggt tctggtggta ttggcaaaag gaaaagatac cgaagtatgt ggaatttatg aaagataatt accctcctag tttcaaatat gaagattttg gaccactatt tacagcaaaa ttttttaatg ccaaccagtg ggcagatatt tttcaggcct ctggtgccaa atacattgtc ttaacttcca aacatcatga aggctttacc ttgtgggggt cagaatattc gtggaactgg aatgccatag atgaggggcc caagagggac attgtcaagg aacttgaggt agccattagg aacagaactg acctgcgttt tggactgtac tattcccttt ttgaatggtt tcatccgctc ttccttgagg atgaatccag ttcattccat aagcggcaat ttccagtttc taagacattg ccagagctct atgagttagt gaacaactat cagcctgagg ttctgtggtc ggatggtgac ggaggagcac cggatcaata ctggaacagc acaggcttct tggcctggtt atataatgaa agcccagttc ggggcacagt agtcaccaat gatcgttggg gagctggtag catctgtaag catggtggct tctatacctg cagtgatcgt tataacccag gacatctttt gccacataaa tgggaaaact gcatgacaat agacaaactg tcctggggct ataggaggga agctggaatc tctgactatc ttacaattga agaattggtg aagcaacttg tagagacagt ttcatgtgga ggaaatcttt tgatgaatat tgggcccaca ctagatggca ccatttctgt agtttttgag gagcgactga ggcaagtggg gtcctggcta aaagtcaatg gagaagctat ttatgaaacc tatacctggc gatcccagaa tgacactgtc accccagatg tgtggtacac atccaagcct aaagaaaaat tagtctatgc catttttctt aaatggccca catcaggaca gctgttcctt ggccatccca aagctattct gggggcaaca gaggtgaaac tactgggcca tggacagcca cttaactgga tttctttgga gcaaaatggc attatggtag aactgccaca gctaaccatt catcagatgc cgtgtaaatg gggctgggct ctagccctaa ctaatgtgat ctaa. It is sometimes possible for the material contained within the vial of "FUCA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
