Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FUCA1 cdna clone

FUCA1 cDNA Clone

Gene Names
FUCA1; FUCA
Synonyms
FUCA1; FUCA1 cDNA Clone; FUCA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggtcgcggccggcgggtcccgcgctgttgctgctgctgctcttcctcggagcggccgagtcggtgcgtcgggcccagcctccgcgccgctacaccccagactggccgagcctggattctcggccgctgccggcctggttcgacgaagccaagttcggggtgttcatccactggggcgtgttctcggtgcccgcctggggcagcgagtggttctggtggcactggcagggcgaggggcggccgcagtaccagcgcttcatgcgcgacaactacccgcccggcttcagctacgccgacttcggaccgcagttcactgcgcgcttcttccacccggaggagtgggccgacctcttccaggccgcgggcgccaagtatgtagttttgacgacaaagcatcacgaaggcttcacaaactggccgagtcctgtgtcttggaactggaactccaaagacgtggggcctcatcgggatttggttggtgaattgggaacagctctccggaagaggaacatccgctatggactataccactcactcttagagtggttccatccactctatctacttgataagaaaaatggcttcaaaacacagcattttgtcagtgcaaaaacaatgccagagctgtacgaccttgttaacagctataaacctgatctgatctggtctgatggggagtgggaatgtcctgatacttactggaactccacaaattttctttcatggctctacaatgacagccctgtcaaggatgaggtggtagtaaatgaccgatggggtcagaactgttcctgtcaccatggaggatactataactgtgaagataaattcaagccacagagcttgccagatcacaagtgggagatgtgcaccagcattgacaagttttcctggggctatcgtcgtgacatggcattgtctgatgttacagaagaatctgaaatcatttcggaactggttcagacagtaagtttgggaggcaactatcttctgaacattggaccaactaaagatggactgattgttcccatcttccaagaaaggcttcttgctgttgggaaatggctgagcatcaatggggaggctatctatgcctccaaaccatggcgggtgcaatgggaaaagaacacaacatctgtatggtatacctcaaagggatcggctgtttatgccatttttctgcactggccagaaaatggagtcttaaaccttgaatcccccataactacctcaactacaaagataacaatgctgggaattcaaggagatctgaagtggtccacagatccagataaaggtctcttcatctctctaccccagttgccaccctctgctgtccccgcagagtttgcttggactataaagctgacaggagtgaagtaa
Sequence Length
1386
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,689 Da
NCBI Official Full Name
Homo sapiens fucosidase, alpha-L- 1, tissue, mRNA
NCBI Official Synonym Full Names
fucosidase, alpha-L- 1, tissue
NCBI Official Symbol
FUCA1
NCBI Official Synonym Symbols
FUCA
NCBI Protein Information
tissue alpha-L-fucosidase
UniProt Protein Name
Tissue alpha-L-fucosidase
Protein Family
UniProt Gene Name
FUCA1
UniProt Synonym Gene Names
Alpha-L-fucosidase 1
UniProt Entry Name
FUCO_HUMAN

NCBI Description

The protein encoded by this gene is a lysosomal enzyme involved in the degradation of fucose-containing glycoproteins and glycolipids. Mutations in this gene are associated with fucosidosis (FUCA1D), which is an autosomal recessive lysosomal storage disease. A pseudogene of this locus is present on chr 2.[provided by RefSeq, Oct 2009]

Uniprot Description

FUCA1: Alpha-L-fucosidase is responsible for hydrolyzing the alpha-1,6-linked fucose joined to the reducing-end N- acetylglucosamine of the carbohydrate moieties of glycoproteins. Defects in FUCA1 are the cause of fucosidosis (FUCA1D). FUCA1D is an autosomal recessive lysosomal storage disease characterized by accumulation of fucose-containing glycolipids and glycoproteins in various tissues. Clinical signs include facial dysmorphism, dysostosis multiplex, moderate hepatomegaly, severe intellectual deficit, deafness, and according to age, angiokeratomas. Belongs to the glycosyl hydrolase 29 family.

Protein type: EC 3.2.1.51; Hydrolase; Glycan Metabolism - other glycan degradation

Chromosomal Location of Human Ortholog: 1p34

Cellular Component: cytoplasm; lysosomal lumen

Molecular Function: alpha-L-fucosidase activity

Biological Process: fucose metabolic process; glycoside catabolic process

Disease: Fucosidosis

Research Articles on FUCA1

Similar Products

Product Notes

The FUCA1 fuca1 (Catalog #AAA1278078) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggtcgc ggccggcggg tcccgcgctg ttgctgctgc tgctcttcct cggagcggcc gagtcggtgc gtcgggccca gcctccgcgc cgctacaccc cagactggcc gagcctggat tctcggccgc tgccggcctg gttcgacgaa gccaagttcg gggtgttcat ccactggggc gtgttctcgg tgcccgcctg gggcagcgag tggttctggt ggcactggca gggcgagggg cggccgcagt accagcgctt catgcgcgac aactacccgc ccggcttcag ctacgccgac ttcggaccgc agttcactgc gcgcttcttc cacccggagg agtgggccga cctcttccag gccgcgggcg ccaagtatgt agttttgacg acaaagcatc acgaaggctt cacaaactgg ccgagtcctg tgtcttggaa ctggaactcc aaagacgtgg ggcctcatcg ggatttggtt ggtgaattgg gaacagctct ccggaagagg aacatccgct atggactata ccactcactc ttagagtggt tccatccact ctatctactt gataagaaaa atggcttcaa aacacagcat tttgtcagtg caaaaacaat gccagagctg tacgaccttg ttaacagcta taaacctgat ctgatctggt ctgatgggga gtgggaatgt cctgatactt actggaactc cacaaatttt ctttcatggc tctacaatga cagccctgtc aaggatgagg tggtagtaaa tgaccgatgg ggtcagaact gttcctgtca ccatggagga tactataact gtgaagataa attcaagcca cagagcttgc cagatcacaa gtgggagatg tgcaccagca ttgacaagtt ttcctggggc tatcgtcgtg acatggcatt gtctgatgtt acagaagaat ctgaaatcat ttcggaactg gttcagacag taagtttggg aggcaactat cttctgaaca ttggaccaac taaagatgga ctgattgttc ccatcttcca agaaaggctt cttgctgttg ggaaatggct gagcatcaat ggggaggcta tctatgcctc caaaccatgg cgggtgcaat gggaaaagaa cacaacatct gtatggtata cctcaaaggg atcggctgtt tatgccattt ttctgcactg gccagaaaat ggagtcttaa accttgaatc ccccataact acctcaacta caaagataac aatgctggga attcaaggag atctgaagtg gtccacagat ccagataaag gtctcttcat ctctctaccc cagttgccac cctctgctgt ccccgcagag tttgcttgga ctataaagct gacaggagtg aagtaa. It is sometimes possible for the material contained within the vial of "FUCA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.