Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FSTL1 cdna clone

FSTL1 cDNA Clone

Gene Names
FSTL1; FRP; FSL1; OCC1; OCC-1; tsc36; MIR198
Synonyms
FSTL1; FSTL1 cDNA Clone; FSTL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggaaacgctggctcgcgctcgcgctcgcgctggtggcggtcgcctgggtccgcgccgaggaagagctaaggagcaaatccaagatctgtgccaatgtgttttgtggagccggccgggaatgtgcagtcacagagaaaggggaacccacctgtctctgcattgagcaatgcaaacctcacaagaggcctgtgtgtggcagtaatggcaagacctacctcaaccactgtgaactgcatcgagatgcctgcctcactggatccaaaatccaggttgattacgatggacactgcaaagagaagaaatccgtaagtccatctgccagcccagttgtttgctatcagtccaaccgtgatgagctccgacgtcgcatcatccagtggctggaagctgagatcattccagatggctggttctctaaaggcagcaactacagtgaaatcctagacaagtattttaagaactttgataatggtgattctcgcctggactccagtgaattcctgaagtttgtggaacagaatgaaactgccatcaatattacaacgtatccagaccaggagaacaacaagttgcttaggggactctgtgttgatgctctcattgaactgtctgatgaaaatgctgattggaaactcagcttccaagagtttctcaagtgcctcaacccatctttcaaccctcctgagaagaagtgtgccctggaggatgaaacgtatgcagatggagctgagaccgaggtggactgtaaccgctgtgtctgtgcctgtggaaattgggtctgtacagccatgacctgtgacggaaagaatcagaagggggcccagacccagacagaggaggagatgaccagatatgtccaggagctccaaaagcatcaggaaacagctgaaaagaccaagagagtgagcaccaaagagatctaa
Sequence Length
927
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,228 Da
NCBI Official Full Name
Homo sapiens follistatin-like 1, mRNA
NCBI Official Synonym Full Names
follistatin like 1
NCBI Official Symbol
FSTL1
NCBI Official Synonym Symbols
FRP; FSL1; OCC1; OCC-1; tsc36; MIR198
NCBI Protein Information
follistatin-related protein 1
UniProt Protein Name
Follistatin-related protein 1
UniProt Gene Name
FSTL1
UniProt Synonym Gene Names
FRP
UniProt Entry Name
FSTL1_HUMAN

NCBI Description

This gene encodes a protein with similarity to follistatin, an activin-binding protein. It contains an FS module, a follistatin-like sequence containing 10 conserved cysteine residues. This gene product is thought to be an autoantigen associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]

Uniprot Description

FSTL1: May modulate the action of some growth factors on cell proliferation and differentiation. Binds heparin.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 3q13.33

Cellular Component: extracellular region; extracellular space

Molecular Function: protein binding

Biological Process: BMP signaling pathway

Research Articles on FSTL1

Similar Products

Product Notes

The FSTL1 fstl1 (Catalog #AAA1268346) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggaaac gctggctcgc gctcgcgctc gcgctggtgg cggtcgcctg ggtccgcgcc gaggaagagc taaggagcaa atccaagatc tgtgccaatg tgttttgtgg agccggccgg gaatgtgcag tcacagagaa aggggaaccc acctgtctct gcattgagca atgcaaacct cacaagaggc ctgtgtgtgg cagtaatggc aagacctacc tcaaccactg tgaactgcat cgagatgcct gcctcactgg atccaaaatc caggttgatt acgatggaca ctgcaaagag aagaaatccg taagtccatc tgccagccca gttgtttgct atcagtccaa ccgtgatgag ctccgacgtc gcatcatcca gtggctggaa gctgagatca ttccagatgg ctggttctct aaaggcagca actacagtga aatcctagac aagtatttta agaactttga taatggtgat tctcgcctgg actccagtga attcctgaag tttgtggaac agaatgaaac tgccatcaat attacaacgt atccagacca ggagaacaac aagttgctta ggggactctg tgttgatgct ctcattgaac tgtctgatga aaatgctgat tggaaactca gcttccaaga gtttctcaag tgcctcaacc catctttcaa ccctcctgag aagaagtgtg ccctggagga tgaaacgtat gcagatggag ctgagaccga ggtggactgt aaccgctgtg tctgtgcctg tggaaattgg gtctgtacag ccatgacctg tgacggaaag aatcagaagg gggcccagac ccagacagag gaggagatga ccagatatgt ccaggagctc caaaagcatc aggaaacagc tgaaaagacc aagagagtga gcaccaaaga gatctaa. It is sometimes possible for the material contained within the vial of "FSTL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.