Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FNDC3B cdna clone

FNDC3B cDNA Clone

Gene Names
FNDC3B; FAD104; PRO4979; YVTM2421
Synonyms
FNDC3B; FNDC3B cDNA Clone; FNDC3B cdna clone
Ordering
For Research Use Only!
Sequence
atgatgatgaccgaccaaatccctctggaactgccaccattgctgaacggagaggtagccatgatgccccacttggtgaatggagatgcagctcagcaggttattctcgttcaagttaatccaggtgagactttcacaataagagcagaggatggaacacttcagtgcattcaagatgaagtggtgaagagagcctgcgattga
Sequence Length
204
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,844 Da
NCBI Official Full Name
Homo sapiens fibronectin type III domain containing 3B, mRNA
NCBI Official Synonym Full Names
fibronectin type III domain containing 3B
NCBI Official Symbol
FNDC3B
NCBI Official Synonym Symbols
FAD104; PRO4979; YVTM2421
NCBI Protein Information
fibronectin type III domain-containing protein 3B
UniProt Protein Name
Fibronectin type III domain-containing protein 3B
UniProt Gene Name
FNDC3B
UniProt Synonym Gene Names
FAD104; NS5ABP37
UniProt Entry Name
FND3B_HUMAN

Uniprot Description

FNDC3B: May be a positive regulator of adipogenesis. Belongs to the FNDC3 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 3q26.31

Research Articles on FNDC3B

Similar Products

Product Notes

The FNDC3B fndc3b (Catalog #AAA1275297) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgatga ccgaccaaat ccctctggaa ctgccaccat tgctgaacgg agaggtagcc atgatgcccc acttggtgaa tggagatgca gctcagcagg ttattctcgt tcaagttaat ccaggtgaga ctttcacaat aagagcagag gatggaacac ttcagtgcat tcaagatgaa gtggtgaaga gagcctgcga ttga. It is sometimes possible for the material contained within the vial of "FNDC3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.