Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FLVCR2 cdna clone

FLVCR2 cDNA Clone

Gene Names
FLVCR2; CCT; EPV; PVHH; MFSD7C; C14orf58; FLVCRL14q
Synonyms
FLVCR2; FLVCR2 cDNA Clone; FLVCR2 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgaatgaaggtcccaaccaggaagagagcgatgacacccctgtgccggagtccgcactccaagcggaccccagcgtctcggtccatcccagcgtctcggtccatcccagcgtctccatcaaccccagcgtctctgtccaccccagcagttcggcccaccccagtgccttagcccaacccagtggcttggctcaccccagtagctcgggccctgaggacctcagcgtgatcaaggtgagcaggcgccgttgggccgtggtcctggtgtttagctgctactccatgtgcaactcctttcagtggatccagtacggctccatcaataacatcttcatgcacttctacggtgtcagtgcctttgccattgactggctgtccatgtgctacatgctgacttacatccctctgctcctgccagtggcttggctgctggagaagttcggcctgcgcaccattgctctcactggctcggctctcaactgcctgggggcctgggtgaagctgggcagcctgaagccgcatctctttccggtcaccgtggtgggccagctcatctgctctgtggcccaggttttcatcctgggcatgccctcccgcatcgcttccgtctggttcggggctaatgaggtttcaacagcctgctccgtggctgtctttggcaatcagcttggaattgcgattgggttcttggtccctcctgttttggtacccaacattgaagaccgggacgagcttgcctaccacatcagcatcatgttctatataataggaggtgtggccactctcctcctcatccttgtcatcattgtgttcaaggagaaacctaaatatccccccagcagggcccaatccctgagctatgccttgacctctcctgatgcctcatacttaggttccatcgcccggctcttcaaaaatctcaactttgtgctgcttgtcatcacctatggtctgaatgctggtgctttttatgccttgtccactcttctgaatcgcatggtgatctggcactacccgggggaagaagtgaatgctggaagaattggcctgacgatcgtcattgcaggaatgcttggggctgtgatctcaggaatctggctggataggtccaaaacctacaaagagacaaccctggtagtctatatcatgacactggtgggcatggtggtgtacacgtttaccttgaacctgggacacctgtgggtagtgttcatcactgctggcacaatgggcttctttatgactggctatctcccactgggatttgagtttgctgtggagctcacgtacccagaatcagaaggcatctcctccggcctcctcaacatatctgcacaggtatttgggatcatctttaccatctcccagggccagattattgacaactatggaaccaagcctgggaacatcttcctgtgtgtgttccttactcttggagcagccctcactgcattcattaaggcagatctccggagacagaaagcaaacaaagaaactcttgagaacaaactccaagaggaggaggaggagagcaacaccagcaaagtgcccactgctgtgtcagaggatcatctctga
Sequence Length
1581
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,262 Da
NCBI Official Full Name
Homo sapiens feline leukemia virus subgroup C cellular receptor family, member 2, mRNA
NCBI Official Synonym Full Names
feline leukemia virus subgroup C cellular receptor family member 2
NCBI Official Symbol
FLVCR2
NCBI Official Synonym Symbols
CCT; EPV; PVHH; MFSD7C; C14orf58; FLVCRL14q
NCBI Protein Information
feline leukemia virus subgroup C receptor-related protein 2
UniProt Protein Name
Feline leukemia virus subgroup C receptor-related protein 2
UniProt Gene Name
FLVCR2
UniProt Synonym Gene Names
C14orf58; CCT
UniProt Entry Name
FLVC2_HUMAN

NCBI Description

This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]

Uniprot Description

FLVCR2: Acts as an importer of heme. Also acts as a transporter for a calcium-chelator complex, important for growth and calcium metabolism. Defects in FLVCR2 are the cause of proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome (PVHH). It is a rare prenatally lethal disorder characterized by hydranencephaly, a distinctive glomerular vasculopathy in the central nervous system and retina, and diffuse ischemic lesions of the brain stem, basal ganglia, and spinal cord with calcifications. Hydranencephaly is a condition where the greater portions of the cerebral hemispheres and corpus striatum are replaced by cerebrospinal fluid and glial tissue. Belongs to the major facilitator superfamily. Feline leukemia virus subgroup C receptor (TC 2.A.1.28.1) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 14q24.3

Molecular Function: heme binding; heme transporter activity

Disease: Proliferative Vasculopathy And Hydranencephaly-hydrocephaly Syndrome

Research Articles on FLVCR2

Similar Products

Product Notes

The FLVCR2 flvcr2 (Catalog #AAA1267104) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaatg aaggtcccaa ccaggaagag agcgatgaca cccctgtgcc ggagtccgca ctccaagcgg accccagcgt ctcggtccat cccagcgtct cggtccatcc cagcgtctcc atcaacccca gcgtctctgt ccaccccagc agttcggccc accccagtgc cttagcccaa cccagtggct tggctcaccc cagtagctcg ggccctgagg acctcagcgt gatcaaggtg agcaggcgcc gttgggccgt ggtcctggtg tttagctgct actccatgtg caactccttt cagtggatcc agtacggctc catcaataac atcttcatgc acttctacgg tgtcagtgcc tttgccattg actggctgtc catgtgctac atgctgactt acatccctct gctcctgcca gtggcttggc tgctggagaa gttcggcctg cgcaccattg ctctcactgg ctcggctctc aactgcctgg gggcctgggt gaagctgggc agcctgaagc cgcatctctt tccggtcacc gtggtgggcc agctcatctg ctctgtggcc caggttttca tcctgggcat gccctcccgc atcgcttccg tctggttcgg ggctaatgag gtttcaacag cctgctccgt ggctgtcttt ggcaatcagc ttggaattgc gattgggttc ttggtccctc ctgttttggt acccaacatt gaagaccggg acgagcttgc ctaccacatc agcatcatgt tctatataat aggaggtgtg gccactctcc tcctcatcct tgtcatcatt gtgttcaagg agaaacctaa atatcccccc agcagggccc aatccctgag ctatgccttg acctctcctg atgcctcata cttaggttcc atcgcccggc tcttcaaaaa tctcaacttt gtgctgcttg tcatcaccta tggtctgaat gctggtgctt tttatgcctt gtccactctt ctgaatcgca tggtgatctg gcactacccg ggggaagaag tgaatgctgg aagaattggc ctgacgatcg tcattgcagg aatgcttggg gctgtgatct caggaatctg gctggatagg tccaaaacct acaaagagac aaccctggta gtctatatca tgacactggt gggcatggtg gtgtacacgt ttaccttgaa cctgggacac ctgtgggtag tgttcatcac tgctggcaca atgggcttct ttatgactgg ctatctccca ctgggatttg agtttgctgt ggagctcacg tacccagaat cagaaggcat ctcctccggc ctcctcaaca tatctgcaca ggtatttggg atcatcttta ccatctccca gggccagatt attgacaact atggaaccaa gcctgggaac atcttcctgt gtgtgttcct tactcttgga gcagccctca ctgcattcat taaggcagat ctccggagac agaaagcaaa caaagaaact cttgagaaca aactccaaga ggaggaggag gagagcaaca ccagcaaagt gcccactgct gtgtcagagg atcatctctg a. It is sometimes possible for the material contained within the vial of "FLVCR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.