FKBP9L cdna clone
FKBP9L cDNA Clone
Gene Names
FKBP9P1; FKBP9L
Synonyms
FKBP9L; FKBP9L cDNA Clone; FKBP9L cdna clone
Sequence
atggacatgggtctcagagagatgtgcgttggcgagaaacggacagtgatcattccgcctcacctgggctatggggaagctggcgtggatggagaagtgcccggcagtgccgtattagtgtttgacattgagctgctggagctggtggctggccttcccgaggggtacatgttcatatggaatggtgaggtgtcacccaacctttttgaagaaattgacaaggatggcaacggagaagtcctcctggaagagttctcagagtacattcacgcccaggtggcatctggcaaagggaaactcgctcctggctttgatgctgagctgattgtgaagaatatgttcaccaaccaggaccggaatggagatgggaaggtcacagctgaggaatttaaactcaaagaccaggaagccaaacaggatgaactctaa
Sequence Length
429
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,591 Da
NCBI Official Full Name
Homo sapiens FK506 binding protein 9-like, mRNA
NCBI Official Synonym Full Names
FK506 binding protein 9 pseudogene 1
NCBI Official Symbol
FKBP9P1
NCBI Official Synonym Symbols
FKBP9L
UniProt Protein Name
Putative FK506-binding protein 9-like protein
UniProt Gene Name
FKBP9P1
UniProt Synonym Gene Names
FKBP9L
UniProt Entry Name
FKB9L_HUMAN
Similar Products
Product Notes
The FKBP9L fkbp9p1 (Catalog #AAA1272903) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacatgg gtctcagaga gatgtgcgtt ggcgagaaac ggacagtgat cattccgcct cacctgggct atggggaagc tggcgtggat ggagaagtgc ccggcagtgc cgtattagtg tttgacattg agctgctgga gctggtggct ggccttcccg aggggtacat gttcatatgg aatggtgagg tgtcacccaa cctttttgaa gaaattgaca aggatggcaa cggagaagtc ctcctggaag agttctcaga gtacattcac gcccaggtgg catctggcaa agggaaactc gctcctggct ttgatgctga gctgattgtg aagaatatgt tcaccaacca ggaccggaat ggagatggga aggtcacagc tgaggaattt aaactcaaag accaggaagc caaacaggat gaactctaa. It is sometimes possible for the material contained within the vial of "FKBP9L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
