Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FIBCD1 cdna clone

FIBCD1 cDNA Clone

Synonyms
FIBCD1; FIBCD1 cDNA Clone; FIBCD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcaacgaccggtggaagaccatgggcggcgctgcccaacttgaggaccggccgcgcgacaagccgcagcggccgagctgcggctacgtgctgtgcaccgtgctgctggccctggctgtgctgctggctgtagctgtcaccggtgccgtgctcttcctgaaccacgcccacgcgccgggcacggcgcccccacctgtcgtcagcactggggctgccagcgccaacagcgccgtggtcactgtggaaagggcggacagctcgcacctcagcatcctcattgacccgcgctgccccgacctcaccgacagcttcgcacgcctggagagcgcccaggcctcggtgctgcaggcgctgacagagcaccaggcccagccacggctggtgggcgaccaggagcaggagctgctggacacgctggccgaccagctgccccggctgctggcccgagcctcagagctgcagacggagtgcatggggctgcggaaggggcatggcacgctgggccagggcctcagcgccctgcagagtgagcagggccgcctcatccagcttctctctgagagccagggccacatggctcacctggtgaactccgtcagcgacatcctggatgccctgcagagggaccgggggctgggccggccccgcaacaaggccgaccttcagagagcgcctgcccggggaacccggccccggggctgtgccactggctcccggccccgagactgtctggacgtcctcctaagcggacagcaggacgatggcgtctactctgtctttcccacccactacccggccggcttccaggtgtactgtgacatgcgcacggacggcggcggctggacggtgtttcagcgccgggaggacggctccgtgaacttcttccggggctgggatgcgtaccgagacggctttggcaggctcaccggggagcactggctagggctcaagaggatccacgccctgaccacacaggctgcctacgagctgcacgtggacctggaggactttgagaatggcacggcctatgcccgctacgggagcttcggcgtgggcttgttctccgtggaccctgaggaagacgggtacccgctcaccgtggctgactattccggcactgcaggcgactccctcctgaagcacagcggcatgaggttcaccaccaaggaccgtgacagcgaccattcagagaacaactgtgccgccttctaccgcggtgcctggtggtaccgcaactgccacacgtccaacctcaatgggcagtacctgcgcggtgcgcacgcctcctatgccgacggcgtggagtggtcctcctggaccggctggcagtactcactcaagttctctgagatgaagatccggccggtccgggaggaccgctag
Sequence Length
1386
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,564 Da
NCBI Official Full Name
Homo sapiens fibrinogen C domain containing 1, mRNA
NCBI Official Synonym Full Names
fibrinogen C domain containing 1
NCBI Official Symbol
FIBCD1
NCBI Protein Information
fibrinogen C domain-containing protein 1
UniProt Protein Name
Fibrinogen C domain-containing protein 1
UniProt Gene Name
FIBCD1
UniProt Entry Name
FBCD1_HUMAN

NCBI Description

FIBCD1 is a conserved type II transmembrane endocytic receptor that binds chitin and is located primarily in the intestinal brush border (Schlosser et al., 2009 [PubMed 19710473]).[supplied by OMIM, Apr 2010]

Uniprot Description

FIBCD1: Acetyl group-binding receptor which shows a high- affinity and calcium-dependent binding to acetylated structures such as chitin, some N-acetylated carbohydrates, and amino acids, but not to their non-acetylated counterparts. Can facilitate the endocytosis of acetylated components. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 9q34.12

Cellular Component: membrane

Molecular Function: chitin binding; protein binding

Research Articles on FIBCD1

Similar Products

Product Notes

The FIBCD1 fibcd1 (Catalog #AAA1277001) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcaacg accggtggaa gaccatgggc ggcgctgccc aacttgagga ccggccgcgc gacaagccgc agcggccgag ctgcggctac gtgctgtgca ccgtgctgct ggccctggct gtgctgctgg ctgtagctgt caccggtgcc gtgctcttcc tgaaccacgc ccacgcgccg ggcacggcgc ccccacctgt cgtcagcact ggggctgcca gcgccaacag cgccgtggtc actgtggaaa gggcggacag ctcgcacctc agcatcctca ttgacccgcg ctgccccgac ctcaccgaca gcttcgcacg cctggagagc gcccaggcct cggtgctgca ggcgctgaca gagcaccagg cccagccacg gctggtgggc gaccaggagc aggagctgct ggacacgctg gccgaccagc tgccccggct gctggcccga gcctcagagc tgcagacgga gtgcatgggg ctgcggaagg ggcatggcac gctgggccag ggcctcagcg ccctgcagag tgagcagggc cgcctcatcc agcttctctc tgagagccag ggccacatgg ctcacctggt gaactccgtc agcgacatcc tggatgccct gcagagggac cgggggctgg gccggccccg caacaaggcc gaccttcaga gagcgcctgc ccggggaacc cggccccggg gctgtgccac tggctcccgg ccccgagact gtctggacgt cctcctaagc ggacagcagg acgatggcgt ctactctgtc tttcccaccc actacccggc cggcttccag gtgtactgtg acatgcgcac ggacggcggc ggctggacgg tgtttcagcg ccgggaggac ggctccgtga acttcttccg gggctgggat gcgtaccgag acggctttgg caggctcacc ggggagcact ggctagggct caagaggatc cacgccctga ccacacaggc tgcctacgag ctgcacgtgg acctggagga ctttgagaat ggcacggcct atgcccgcta cgggagcttc ggcgtgggct tgttctccgt ggaccctgag gaagacgggt acccgctcac cgtggctgac tattccggca ctgcaggcga ctccctcctg aagcacagcg gcatgaggtt caccaccaag gaccgtgaca gcgaccattc agagaacaac tgtgccgcct tctaccgcgg tgcctggtgg taccgcaact gccacacgtc caacctcaat gggcagtacc tgcgcggtgc gcacgcctcc tatgccgacg gcgtggagtg gtcctcctgg accggctggc agtactcact caagttctct gagatgaaga tccggccggt ccgggaggac cgctag. It is sometimes possible for the material contained within the vial of "FIBCD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.