FHL5 cdna clone
FHL5 cDNA Clone
Gene Names
FHL5; ACT; FHL-5; dJ393D12.2; 1700027G07Rik
Synonyms
FHL5; FHL5 cDNA Clone; FHL5 cdna clone
Sequence
atgacaactgctcacttttactgtcaatactgcacagcatcacttcttgggaagaaatatgtactaaaggatgacagtccatactgtgttacatgttatgatcgtgtattttctaactattgcgaggaatgcaaaaaaccaattgaatctgattctaaggatctttgttacaaagaccggcactggcatgaaggatgcttcaagtgcaccaaatgcaatcactctttggtggaaaagccttttgctgccaaggatgagcgcctgctgtgcacggagtgctattctaacgagtgctcctccaagtgcttccactgcaagaggaccatcatgcctggttcccgcaaaatggaatttaagggaaactactggcatgaaacctgttttgtgtgtgagaattgccgacaacctatagggacaaagcctttgatctccaaagagagtggcaattattgtgtgccatgttttgagaaggagtttgctcactactgcaacttttgtaagaaggtgataacttcaggtgggataacattttgtgaccagctatggcataaagagtgttttctgtgtagtgactgtaggaaagatctctgtgaagaacagttcatgtccagagacgactatccattctgcatggactgctacaaccatctttatgccaacaagtgtgtagcctgttccaaacccattagtggtctcacaggtgccaagtttatctgctttcaagacagccagtggcatagcgaatgctttaactgcgggaaatgctctgtctccttggtgggtaaaggcttcctgacccagaacaaggaaatcttctgccaaaaatgtggctccggaatggacactgacatctag
Sequence Length
855
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,720 Da
NCBI Official Full Name
Homo sapiens four and a half LIM domains 5, mRNA
NCBI Official Synonym Full Names
four and a half LIM domains 5
NCBI Official Symbol
FHL5
NCBI Official Synonym Symbols
ACT; FHL-5; dJ393D12.2; 1700027G07Rik
NCBI Protein Information
four and a half LIM domains protein 5
UniProt Protein Name
Four and a half LIM domains protein 5
Protein Family
UniProt Gene Name
FHL5
UniProt Synonym Gene Names
ACT; FHL-5; Activator of CREM in testis
UniProt Entry Name
FHL5_HUMAN
NCBI Description
The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Polymorphisms in this gene may be associated with susceptibility for migraine headaches. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Apr 2016]
Uniprot Description
FHL5: May be involved in the regulation of spermatogenesis. Stimulates CREM transcriptional activity in a phosphorylation- independent manner.
Chromosomal Location of Human Ortholog: 6q16.1-q16.3
Molecular Function: protein binding
Research Articles on FHL5
Similar Products
Product Notes
The FHL5 fhl5 (Catalog #AAA1273309) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacaactg ctcactttta ctgtcaatac tgcacagcat cacttcttgg gaagaaatat gtactaaagg atgacagtcc atactgtgtt acatgttatg atcgtgtatt ttctaactat tgcgaggaat gcaaaaaacc aattgaatct gattctaagg atctttgtta caaagaccgg cactggcatg aaggatgctt caagtgcacc aaatgcaatc actctttggt ggaaaagcct tttgctgcca aggatgagcg cctgctgtgc acggagtgct attctaacga gtgctcctcc aagtgcttcc actgcaagag gaccatcatg cctggttccc gcaaaatgga atttaaggga aactactggc atgaaacctg ttttgtgtgt gagaattgcc gacaacctat agggacaaag cctttgatct ccaaagagag tggcaattat tgtgtgccat gttttgagaa ggagtttgct cactactgca acttttgtaa gaaggtgata acttcaggtg ggataacatt ttgtgaccag ctatggcata aagagtgttt tctgtgtagt gactgtagga aagatctctg tgaagaacag ttcatgtcca gagacgacta tccattctgc atggactgct acaaccatct ttatgccaac aagtgtgtag cctgttccaa acccattagt ggtctcacag gtgccaagtt tatctgcttt caagacagcc agtggcatag cgaatgcttt aactgcggga aatgctctgt ctccttggtg ggtaaaggct tcctgaccca gaacaaggaa atcttctgcc aaaaatgtgg ctccggaatg gacactgaca tctag. It is sometimes possible for the material contained within the vial of "FHL5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
