FGL2 cdna clone
FGL2 cDNA Clone
Gene Names
FGL2; T49; pT49
Synonyms
FGL2; FGL2 cDNA Clone; FGL2 cdna clone
Sequence
atgaagctggctaactggtactggctgagctcagctgttcttgccacttacggttttttggttgtggcaaacaatgaaacagaggaaattaaagatgaaagagcaaaggatgtctgcccagtgagactagaaagcagagggaaatgcgaagaggcaggggagtgcccctaccaggtaagcctgccccccttgactattcagctcccgaagcaattcagcaggatcgaggaggtgttcaaagaagtccaaaacctcaaggaaatcgtaaatagtctaaagaaatcttgccaagactgcaagctgcaggctgatgacaacggagacccaggcagaaacggactgttgttacccagtacaggagccccgggagaggttggtgataacagagttagagaattagagagtgaggttaacaagctgtcctctgagctaaagaatgccaaagaggagatcaatgtacttcatggtcgcctggagaagctgaatcttgtaaatatgaacaacatagaaaattatgttgacagcaaagtggcaaatctaacatttgttgtcaatagtttggatggcaaatgttcaaagtgtcccagccaagaacaaatacagtcacgtccagttcaacatctaatatataaagattgctctgactactacgcaataggcaaaagaagcagtgagacctacagagttacacctgatcccaaaaatagtagctttgaagtttactgtgacatggagaccatggggggaggctggacagtgctgcaggcacgtctcgatgggagcaccaacttcaccagaacatggcaagactacaaagcaggctttggaaacctcagaagggaattttggctggggaacgataaaattcatcttctgaccaagagtaaggaaatgattctgagaatagatcttgaagactttaatggtgtcgaactatatgccttgtatgatcagttttatgtggctaatgagtttctcaaatatcgtttacacgttggtaactataatggcacagctggagatgcattacgtttcaacaaacattacaaccacgatctgaagtttttcaccactccagataaagacaatgatcgatatccttctgggaactgtgggctgtactacagttcaggctggtggtttgatgcatgtctttctgcaaacttaaatggcaaatattatcaccaaaaatacagaggtgtccgtaatgggattttctggggtacctggcctggtgtaagtgaggcacaccctggtggctacaagtcctccttcaaagaggctaagatgatgatcagacccaagcactttaagccataa
Sequence Length
1320
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,229 Da
NCBI Official Full Name
Homo sapiens fibrinogen-like 2, mRNA
NCBI Official Synonym Full Names
fibrinogen like 2
NCBI Official Symbol
FGL2
NCBI Official Synonym Symbols
T49; pT49
NCBI Protein Information
fibroleukin
UniProt Protein Name
Fibroleukin
Protein Family
UniProt Gene Name
FGL2
UniProt Entry Name
FGL2_HUMAN
NCBI Description
The protein encoded by this gene is a secreted protein that is similar to the beta- and gamma-chains of fibrinogen. The carboxyl-terminus of the encoded protein consists of the fibrinogen-related domains (FRED). The encoded protein forms a tetrameric complex which is stabilized by interchain disulfide bonds. This protein may play a role in physiologic functions at mucosal sites. [provided by RefSeq, Jul 2008]
Uniprot Description
FGL2: May play a role in physiologic lymphocyte functions at mucosal sites.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 7q11.23
Cellular Component: fibrinogen complex
Research Articles on FGL2
Similar Products
Product Notes
The FGL2 fgl2 (Catalog #AAA1270756) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctgg ctaactggta ctggctgagc tcagctgttc ttgccactta cggttttttg gttgtggcaa acaatgaaac agaggaaatt aaagatgaaa gagcaaagga tgtctgccca gtgagactag aaagcagagg gaaatgcgaa gaggcagggg agtgccccta ccaggtaagc ctgcccccct tgactattca gctcccgaag caattcagca ggatcgagga ggtgttcaaa gaagtccaaa acctcaagga aatcgtaaat agtctaaaga aatcttgcca agactgcaag ctgcaggctg atgacaacgg agacccaggc agaaacggac tgttgttacc cagtacagga gccccgggag aggttggtga taacagagtt agagaattag agagtgaggt taacaagctg tcctctgagc taaagaatgc caaagaggag atcaatgtac ttcatggtcg cctggagaag ctgaatcttg taaatatgaa caacatagaa aattatgttg acagcaaagt ggcaaatcta acatttgttg tcaatagttt ggatggcaaa tgttcaaagt gtcccagcca agaacaaata cagtcacgtc cagttcaaca tctaatatat aaagattgct ctgactacta cgcaataggc aaaagaagca gtgagaccta cagagttaca cctgatccca aaaatagtag ctttgaagtt tactgtgaca tggagaccat ggggggaggc tggacagtgc tgcaggcacg tctcgatggg agcaccaact tcaccagaac atggcaagac tacaaagcag gctttggaaa cctcagaagg gaattttggc tggggaacga taaaattcat cttctgacca agagtaagga aatgattctg agaatagatc ttgaagactt taatggtgtc gaactatatg ccttgtatga tcagttttat gtggctaatg agtttctcaa atatcgttta cacgttggta actataatgg cacagctgga gatgcattac gtttcaacaa acattacaac cacgatctga agtttttcac cactccagat aaagacaatg atcgatatcc ttctgggaac tgtgggctgt actacagttc aggctggtgg tttgatgcat gtctttctgc aaacttaaat ggcaaatatt atcaccaaaa atacagaggt gtccgtaatg ggattttctg gggtacctgg cctggtgtaa gtgaggcaca ccctggtggc tacaagtcct ccttcaaaga ggctaagatg atgatcagac ccaagcactt taagccataa. It is sometimes possible for the material contained within the vial of "FGL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
