Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FGFR1OP2 cdna clone

FGFR1OP2 cDNA Clone

Gene Names
FGFR1OP2; WIT3.0; HSPC123-like
Synonyms
FGFR1OP2; FGFR1OP2 cDNA Clone; FGFR1OP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagttgcacaattgagaaggcacttgccgacgctaaagctcttgttgaaagattaagagatcatgacgatgcagcagaatctctgattgagcaaaccacagctctcaacaagcgagtagaagccatgaaacagtatcaggaagaaattcaagaacttaatgaagtcgcgagacatcggccacggtccacgttagttatgggaatccagcaagaaaacagacaaatcagagagttgcaacaagaaaacaaagaattacgtacatctctggaagaacatcagtcggccttggaacttataatgagcaagtaccgagaacaaatgtttagattgctaatggctagcaaaaaagatgatccgggtataataatgaagttaaaagagcagcactccaagattgacatggtacatcgtaacaagtccgaaggattcttccttgatgcatctcgacacatccttgaagcacctcaacatggactggagagaaggcacttggaagcaaatcagaatgtacactaa
Sequence Length
519
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,175 Da
NCBI Official Full Name
Homo sapiens FGFR1 oncogene partner 2, mRNA
NCBI Official Synonym Full Names
FGFR1 oncogene partner 2
NCBI Official Symbol
FGFR1OP2
NCBI Official Synonym Symbols
WIT3.0; HSPC123-like
NCBI Protein Information
FGFR1 oncogene partner 2
UniProt Protein Name
FGFR1 oncogene partner 2
Protein Family
UniProt Gene Name
FGFR1OP2
UniProt Entry Name
FGOP2_HUMAN

Uniprot Description

FGFR1OP2: May be involved in wound healing pathway. A chromosomal aberration involving FGFR1OP2 may be a cause of stem cell myeloproliferative disorder (MPD). Insertion ins(12;8)(p11;p11p22) with FGFR1. MPD is characterized by myeloid hyperplasia, eosinophilia and T-cell or B-cell lymphoblastic lymphoma. In general it progresses to acute myeloid leukemia. The fusion protein FGFR1OP2-FGFR1 may exhibit constitutive kinase activity and be responsible for the transforming activity. Belongs to the SIKE family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 12p11.23

Cellular Component: cytosol

Molecular Function: protein binding; protein-tyrosine kinase activity

Research Articles on FGFR1OP2

Similar Products

Product Notes

The FGFR1OP2 fgfr1op2 (Catalog #AAA1266797) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagttgca caattgagaa ggcacttgcc gacgctaaag ctcttgttga aagattaaga gatcatgacg atgcagcaga atctctgatt gagcaaacca cagctctcaa caagcgagta gaagccatga aacagtatca ggaagaaatt caagaactta atgaagtcgc gagacatcgg ccacggtcca cgttagttat gggaatccag caagaaaaca gacaaatcag agagttgcaa caagaaaaca aagaattacg tacatctctg gaagaacatc agtcggcctt ggaacttata atgagcaagt accgagaaca aatgtttaga ttgctaatgg ctagcaaaaa agatgatccg ggtataataa tgaagttaaa agagcagcac tccaagattg acatggtaca tcgtaacaag tccgaaggat tcttccttga tgcatctcga cacatccttg aagcacctca acatggactg gagagaaggc acttggaagc aaatcagaat gtacactaa. It is sometimes possible for the material contained within the vial of "FGFR1OP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.