Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FGFR1OP cdna clone

FGFR1OP cDNA Clone

Gene Names
FGFR1OP; FOP
Synonyms
FGFR1OP; FGFR1OP cDNA Clone; FGFR1OP cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgacggcggccgcagtggtggccgaggaggacacggagctgcgggacctgctggtgcagacgctggagaacagcggggtcctgaaccgcatcaaggctgaactccgagcagctgtgtttttagcactagaggagcaagaaaaagtagagaacaaaactcctttagttaatgagagcctgagaaagtttttaaataccaaagacggtcgtttagtggctagtcttgttgcagaatttcttcagttttttaaccttgactttactttggctgtttttcaacctgaaactagcacactgcaaggtctcgaaggtcgagagaatttagcccgagatttaggtataattgaagcagaaggtactgtgggtggacccttattattagaagtgatcaggcgctgtcaacagaaagaaaaagggccaaccactggggaaggtgcacttgatctatctgatgtacattctccaccaaagtcaccagagggaaaaacaagtgcacagacaacaccaagtaagaaggccaatgatgaggccaatcagagtgatacaagtgtctccttgtcagaacccaagagcaaaagcagccttcacttactgtcccatgaaacaaaaattggatcttttctaagcaacagaactttagatggcaaagacaaagctggcctttgtccagatgaagatgatatggaaggagattctttctttgatgatcccattcctaagccagagaaaacttacggtttgaggaatgaacctaggaagcaagcaggaagtctggcctcgctctcggatgcaccccccttaaaaagtggactcagctccctggcgggagccccttctttaaaagactctgagagtaaaaggggaaatacagttttgaaagatctgaaattgatcagtgataaaattggatcacttggattaggaactggagaagatgatgactatgttgatgattttaatagtaccagccatcgctcagagaaaagtgagataagtattggtgaagagatagaagaagacctttctgtggaaatagatgacatcaataccagtgataagcttgatgacctcacacaagatctgactgtatcccagctcagtgatgttgcggattatctggaagatgttgcatag
Sequence Length
1140
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,106 Da
NCBI Official Full Name
Homo sapiens FGFR1 oncogene partner, mRNA
NCBI Official Synonym Full Names
FGFR1 oncogene partner
NCBI Official Symbol
FGFR1OP
NCBI Official Synonym Symbols
FOP
NCBI Protein Information
FGFR1 oncogene partner
UniProt Protein Name
FGFR1 oncogene partner
Protein Family
UniProt Gene Name
FGFR1OP
UniProt Synonym Gene Names
FOP
UniProt Entry Name
FR1OP_HUMAN

NCBI Description

This gene encodes a largely hydrophilic centrosomal protein that is required for anchoring microtubules to subcellular structures. A t(6;8)(q27;p11) chromosomal translocation, fusing this gene and the fibroblast growth factor receptor 1 (FGFR1) gene, has been found in cases of myeloproliferative disorder. The resulting chimeric protein contains the N-terminal leucine-rich region of this encoded protein fused to the catalytic domain of FGFR1. Alterations in this gene may also be associated with Crohn's disease, Graves' disease, and vitiligo. Alternatively spliced transcript variants that encode different proteins have been identified. [provided by RefSeq, Jul 2013]

Uniprot Description

FOP: Required for anchoring microtubules to the centrosomes. A chromosomal aberration involving FGFR1OP may be a cause of stem cell myeloproliferative disorder (MPD). Translocation t(6;8)(q27;p11) with FGFR1. MPD is characterized by myeloid hyperplasia, eosinophilia and T-cell or B-cell lymphoblastic lymphoma. In general it progresses to acute myeloid leukemia. The fusion proteins FGFR1OP-FGFR1 or FGFR1-FGFR1OP may exhibit constitutive kinase activity and be responsible for the transforming activity. Belongs to the FGFR1OP family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 6q27

Cellular Component: centrosome; cytosol; nucleus; perinuclear region of cytoplasm

Molecular Function: protein binding; protein homodimerization activity; protein kinase binding; protein tyrosine kinase inhibitor activity; protein-tyrosine kinase activity

Biological Process: G2/M transition of mitotic cell cycle; negative regulation of protein kinase activity; positive regulation of cell growth; positive regulation of cell migration; positive regulation of cell proliferation

Research Articles on FGFR1OP

Similar Products

Product Notes

The FGFR1OP fgfr1op (Catalog #AAA1269232) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga cggcggccgc agtggtggcc gaggaggaca cggagctgcg ggacctgctg gtgcagacgc tggagaacag cggggtcctg aaccgcatca aggctgaact ccgagcagct gtgtttttag cactagagga gcaagaaaaa gtagagaaca aaactccttt agttaatgag agcctgagaa agtttttaaa taccaaagac ggtcgtttag tggctagtct tgttgcagaa tttcttcagt tttttaacct tgactttact ttggctgttt ttcaacctga aactagcaca ctgcaaggtc tcgaaggtcg agagaattta gcccgagatt taggtataat tgaagcagaa ggtactgtgg gtggaccctt attattagaa gtgatcaggc gctgtcaaca gaaagaaaaa gggccaacca ctggggaagg tgcacttgat ctatctgatg tacattctcc accaaagtca ccagagggaa aaacaagtgc acagacaaca ccaagtaaga aggccaatga tgaggccaat cagagtgata caagtgtctc cttgtcagaa cccaagagca aaagcagcct tcacttactg tcccatgaaa caaaaattgg atcttttcta agcaacagaa ctttagatgg caaagacaaa gctggccttt gtccagatga agatgatatg gaaggagatt ctttctttga tgatcccatt cctaagccag agaaaactta cggtttgagg aatgaaccta ggaagcaagc aggaagtctg gcctcgctct cggatgcacc ccccttaaaa agtggactca gctccctggc gggagcccct tctttaaaag actctgagag taaaagggga aatacagttt tgaaagatct gaaattgatc agtgataaaa ttggatcact tggattagga actggagaag atgatgacta tgttgatgat tttaatagta ccagccatcg ctcagagaaa agtgagataa gtattggtga agagatagaa gaagaccttt ctgtggaaat agatgacatc aataccagtg ataagcttga tgacctcaca caagatctga ctgtatccca gctcagtgat gttgcggatt atctggaaga tgttgcatag. It is sometimes possible for the material contained within the vial of "FGFR1OP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.