Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FGFR1 cdna clone

FGFR1 cDNA Clone

Gene Names
FGFR1; CEK; FLG; HH2; OGD; ECCL; FLT2; KAL2; BFGFR; CD331; FGFBR; FLT-2; HBGFR; N-SAM; FGFR-1; HRTFDS; bFGF-R-1
Synonyms
FGFR1; FGFR1 cDNA Clone; FGFR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggagctggaagtgcctcctcttctgggctgtgctggtcacagccacactctgcaccgctaggccgtccccgaccttgcctgaacaagcccagccctggggagcccctgtggaagtggagtccttcctggtccaccccggtgacctgctgcagcttcgctgtcggctgcgggacgatgtgcagagcatcaactggctgcgggacggggtgcagctggcggaaagcaaccgcacccgcatcacaggggaggaggtggaggtgcaggactccgtgcccgcagactccggcctctatgcttgcgtaaccagcagcccctcgggcagtgacaccacctacttctccgtcaatgtttcagatgctctcccctcctcggaggatgatgatgatgatgatgactcctcttcagaggagaaagaaacagataacaccaaaccaaaccgtatgcccgtagctccatattggacatccccagaaaagatggaaaagaaattgcatgcagtgccggctgccaagacagtgaagttcaaatgcccttccagtgggaccccaaaccccacactgcgctggttgaaaaatggcaaagaattcaaacctgaccacagaattggaggctacaaggtccgttatgccacctggagcatcataatggactctgtggtgccctctgacaagggcaactacacctgcattgtggagaatgagtacggcagcatcaaccacacataccagctggatgtcgtggagcggtcccctcaccggcccatcctgcaagcagggttgcccgccaacaaaacagtggccctgggtagcaacgtggagttcatgtgtaaggtgtacagtgacccgcagccgcacatccagtggctaaagcacatcgaggtgaatgggagcaagattggcccagacaacctgccttatgtccagatcttgaagactgctggagttaataccaccgacaaagagatggaggtgcttcacttaagaaatgtctcctttgaggacgcaggggagtatacgtgcttggcgggtaactctatcggactctcccatcactctgcatggttgaccgttctggaagccctggaagagaggccggcagtgatgacctcgcccctgtacctggagatcatcatctattgcacaggggccttcctcatctcctgcatggtggggtcggtcatcgtctacaagatgaagagtggtaccaagaagagtgacttccacagccagatggctgtgcacaagctggccaagagcatccctctgcgcagacaggtgtctgctgactccagtgcatccatgaactctggggttcttctggttcggccatcacggctctcctccagtgggactcccatgctagcaggggtctctgagtatgagcttcccgaagaccctcgctgggagctgcctcgggacagactggtcttaggcaaacccctgggagagggctgctttgggcaggtggtgttggcagaggctatcgggctggacaaggacaaacccaaccgtgtgaccaaagtggctgtgaagatgttgaagtcggacgcaacagagaaagacttgtcagacctgatctcagaaatggagatgatgaagatgatcgggaagcataagaatatcatcaacctgctgggggcctgcacgcaggatggtcccttgtatgtcatcgtggagtatgcctccaagggcaacctgcgggagtacctgcaggcccggaggcccccagggctggaatactgctacaaccccagccacaacccagaggagcagctctcctccaaggacctggtgtcctgcgcctaccaggtggcccgaggcatggagtatctggcctccaagaagtgcatacaccgagacctggcagccaggaatgtcctggtgacagaggacaatgtgatgaagatagcagactttggcctcgcacgggacattcaccacatcgactactataaaaagacaaccaacggccgactgcctgtgaagtggatggcacccgaggcattatttgaccggatctacacccaccagagtgatgtgtggtctttcggggtgctcctgtgggagatcttcactctgggcggctccccataccccggtgtgcctgtggaggaacttttcaagctgctgaaggagggtcaccgcatggacaagcccagtaactgcaccaacgagctgtacatgatgatgcgggactgctggcatgcagtgccctcacagagacccaccttcaagcagctggtggaagacctggaccgcatcgtggccttgacctccaaccaggagtacctggacctgtccatgcccctggaccagtactcccccagctttcccgacacccggagctctacgtgctcctcaggggaggattccgtcttctctcatgagccgctgcccgaggagccctgcctgccccgacacccagcccagcttgccaatggcggactcaaacgccgctga
Sequence Length
2463
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
95,344 Da
NCBI Official Full Name
Homo sapiens fibroblast growth factor receptor 1, mRNA
NCBI Official Synonym Full Names
fibroblast growth factor receptor 1
NCBI Official Symbol
FGFR1
NCBI Official Synonym Symbols
CEK; FLG; HH2; OGD; ECCL; FLT2; KAL2; BFGFR; CD331; FGFBR; FLT-2; HBGFR; N-SAM; FGFR-1; HRTFDS; bFGF-R-1
NCBI Protein Information
fibroblast growth factor receptor 1
UniProt Protein Name
Fibroblast growth factor receptor 1
Protein Family
UniProt Gene Name
FGFR1
UniProt Synonym Gene Names
BFGFR; CEK; FGFBR; FLG; FLT2; HBGFR; FGFR-1; BFGFR; bFGF-R-1; FLT-2
UniProt Entry Name
FGFR1_HUMAN

NCBI Description

The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

FGFR1: a receptor tyrosine kinase of the highly-conserved fibroblast growth factor receptor (FGFR). Binds both acidic and basic fibroblast growth factors and is involved in limb induction. Point mutations cause Pfeffer syndrome (finger and toe malformations and other skeletal errors) and dominant Kallmann syndrome 2. Stem cell leukemia lymphoma syndrome (SCLL) may be caused by a t(8;13)(p12;q12) translocation that fuses a zinc finger gene, ZNF198, to FGFR1. Various myeloproliferative disorders have been linked to translocations that fuse FGFR1 to FOP, FIM, CEP1 or the atypical kinase, Bcr. Inhibitor: SU5402. 20 isoforms of the human protein produced by alternative splicing have been described.

Protein type: EC 2.7.10.1; FGFR family; Kinase, protein; Membrane protein, integral; Oncoprotein; Protein kinase, TK; Protein kinase, tyrosine (receptor); TK group

Chromosomal Location of Human Ortholog: 8p11.23-p11.22

Cellular Component: integral to plasma membrane; plasma membrane; receptor complex

Molecular Function: 1-phosphatidylinositol-3-kinase activity; fibroblast growth factor binding; fibroblast growth factor receptor activity; heparin binding; identical protein binding; phosphatidylinositol-4,5-bisphosphate 3-kinase activity; protein binding; protein homodimerization activity; protein-tyrosine kinase activity; Ras guanyl-nucleotide exchange factor activity

Biological Process: cell migration; chordate embryonic development; fibroblast growth factor receptor signaling pathway; MAPKKK cascade; neuron migration; peptidyl-tyrosine phosphorylation; phosphoinositide-mediated signaling; positive regulation of cell proliferation; positive regulation of MAP kinase activity; positive regulation of MAPKKK cascade; positive regulation of neuron differentiation; positive regulation of phosphoinositide 3-kinase cascade; protein amino acid autophosphorylation; regulation of cell differentiation; regulation of phosphoinositide 3-kinase cascade; skeletal development; skeletal morphogenesis

Disease: Encephalocraniocutaneous Lipomatosis; Hypogonadotropic Hypogonadism 2 With Or Without Anosmia; Jackson-weiss Syndrome; Osteoglophonic Dysplasia; Pfeiffer Syndrome; Trigonocephaly 1

Research Articles on FGFR1

Similar Products

Product Notes

The FGFR1 fgfr1 (Catalog #AAA1267656) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggagct ggaagtgcct cctcttctgg gctgtgctgg tcacagccac actctgcacc gctaggccgt ccccgacctt gcctgaacaa gcccagccct ggggagcccc tgtggaagtg gagtccttcc tggtccaccc cggtgacctg ctgcagcttc gctgtcggct gcgggacgat gtgcagagca tcaactggct gcgggacggg gtgcagctgg cggaaagcaa ccgcacccgc atcacagggg aggaggtgga ggtgcaggac tccgtgcccg cagactccgg cctctatgct tgcgtaacca gcagcccctc gggcagtgac accacctact tctccgtcaa tgtttcagat gctctcccct cctcggagga tgatgatgat gatgatgact cctcttcaga ggagaaagaa acagataaca ccaaaccaaa ccgtatgccc gtagctccat attggacatc cccagaaaag atggaaaaga aattgcatgc agtgccggct gccaagacag tgaagttcaa atgcccttcc agtgggaccc caaaccccac actgcgctgg ttgaaaaatg gcaaagaatt caaacctgac cacagaattg gaggctacaa ggtccgttat gccacctgga gcatcataat ggactctgtg gtgccctctg acaagggcaa ctacacctgc attgtggaga atgagtacgg cagcatcaac cacacatacc agctggatgt cgtggagcgg tcccctcacc ggcccatcct gcaagcaggg ttgcccgcca acaaaacagt ggccctgggt agcaacgtgg agttcatgtg taaggtgtac agtgacccgc agccgcacat ccagtggcta aagcacatcg aggtgaatgg gagcaagatt ggcccagaca acctgcctta tgtccagatc ttgaagactg ctggagttaa taccaccgac aaagagatgg aggtgcttca cttaagaaat gtctcctttg aggacgcagg ggagtatacg tgcttggcgg gtaactctat cggactctcc catcactctg catggttgac cgttctggaa gccctggaag agaggccggc agtgatgacc tcgcccctgt acctggagat catcatctat tgcacagggg ccttcctcat ctcctgcatg gtggggtcgg tcatcgtcta caagatgaag agtggtacca agaagagtga cttccacagc cagatggctg tgcacaagct ggccaagagc atccctctgc gcagacaggt gtctgctgac tccagtgcat ccatgaactc tggggttctt ctggttcggc catcacggct ctcctccagt gggactccca tgctagcagg ggtctctgag tatgagcttc ccgaagaccc tcgctgggag ctgcctcggg acagactggt cttaggcaaa cccctgggag agggctgctt tgggcaggtg gtgttggcag aggctatcgg gctggacaag gacaaaccca accgtgtgac caaagtggct gtgaagatgt tgaagtcgga cgcaacagag aaagacttgt cagacctgat ctcagaaatg gagatgatga agatgatcgg gaagcataag aatatcatca acctgctggg ggcctgcacg caggatggtc ccttgtatgt catcgtggag tatgcctcca agggcaacct gcgggagtac ctgcaggccc ggaggccccc agggctggaa tactgctaca accccagcca caacccagag gagcagctct cctccaagga cctggtgtcc tgcgcctacc aggtggcccg aggcatggag tatctggcct ccaagaagtg catacaccga gacctggcag ccaggaatgt cctggtgaca gaggacaatg tgatgaagat agcagacttt ggcctcgcac gggacattca ccacatcgac tactataaaa agacaaccaa cggccgactg cctgtgaagt ggatggcacc cgaggcatta tttgaccgga tctacaccca ccagagtgat gtgtggtctt tcggggtgct cctgtgggag atcttcactc tgggcggctc cccatacccc ggtgtgcctg tggaggaact tttcaagctg ctgaaggagg gtcaccgcat ggacaagccc agtaactgca ccaacgagct gtacatgatg atgcgggact gctggcatgc agtgccctca cagagaccca ccttcaagca gctggtggaa gacctggacc gcatcgtggc cttgacctcc aaccaggagt acctggacct gtccatgccc ctggaccagt actcccccag ctttcccgac acccggagct ctacgtgctc ctcaggggag gattccgtct tctctcatga gccgctgccc gaggagccct gcctgccccg acacccagcc cagcttgcca atggcggact caaacgccgc tga. It is sometimes possible for the material contained within the vial of "FGFR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.