Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FGD2 cdna clone

FGD2 cDNA Clone

Gene Names
FGD2; ZFYVE4
Synonyms
FGD2; FGD2 cDNA Clone; FGD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagggggcaagtgaggagaagctggcatctgtgtccaacctggtcactgtgtttgagaatagcaggaccccagaagcagcacccagaggccagaggctagaggacgtgcatcaccgccctgagtgcaggcctcccgagtccccaggaccacgggagaagacgaatgtcggggaggccgtggggtctgagcccaggacagtcagcaggaggtacctgaactccctgaagaacaagctgtccagcgaagcctggaggaaatcttgccagcctgtgaccctctcaggatcggggacacaggagccagagaagaagatcgtccaggagctgctggagacagagcaggcctatgtggcgcgcctccacctgctagaccaggtgtttttccaggagctgctgaagacagcccgcagcagcaaggccttcccagaggatgtggtcagggtcatcttctccaacatctcctccatctatcagttccattctcagttcttcctcccagagctgcagcggcgcctggacgactggacagctaacccccgcatcggtgacgtgatccagaagctggcccccttcctgaagatgtacagtgagtatgtcaagaactttgagcgagcggctgagctgctggccacctggaccgacaagtctccactcttccaggaggttctcactcgcatccagagcagcgaggcttcgggcagcctgaccctgcagcaccacatgctggaaccagtgcagagaattccacgttacgagctgctgctcaaggagtacatccagaagctgccagcccaggccccagaccaggccgatgcccagaaagccctggacatgatcttctcagctgcccagcactccaatgcagccatcactgagatggagcggctgcaggacctgtgggaggtgtaccagcgcctgggcctcgaggacgacatagtagacccctctaacaccctgctccgtgagggcccggtcctcaagatctccttccgccgcaacgaccccatggagcgctaccttttcttgttcaacaacatgctgctctactgtgtgcccagggtgatccaggtgggcgcccagttccaggtgaggacccgcatcgatgtggccgggatgaaggtgcgggagctgatggatgctgagtttccccactccttcctggtgtccgggaagcagcgcaccctggagctgcaagcccggtcccaggaggaaatgatttcctggatgcaggccttccaagcagccattgaccaaatcgagaagcggaatgaaaccttcaaggctgcggcccaggggcctgagggagacatccaggagcaggagctgcagtctgaggagctgggcctccgggcaccgcagtgggtccgggacaagatggtgaccatgtgcatgcgctgccaggagcccttcaacgctctgacgcgccgtcgccaccactgccgggcctgcggctatgtggtgtgtgccaggtgctccgactaccgggccgaactgaaatacgacgacaacaggcccaaccgagtctgcctccactgctacgcattcctcactggaaatgtgctgcctgaggccaaggaggacaagaggcggggcatcctggagaaagggtcctcagccacacctgaccagagcctgatgtgcagcttcctgcagctcatcggggacaagtggggcaagagcggcccccggggctggtgtgtgatccctcgggatgaccccctcgtgctctatgtctatgctgcccctcaggacatgagggctcacacctccatccccctgctgggctaccaggtgactgttgggccccagggggaccctcgggtcttccagctacagcagtcaggccagctctacaccttcaaggccgagacggaggagctgaagggccgctgggtgaaggccatggagcgggcggccagtggctggagccccagctggcccaacgatggggacctgtccgactga
Sequence Length
1968
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,825 Da
NCBI Official Full Name
Homo sapiens FYVE, RhoGEF and PH domain containing 2, mRNA
NCBI Official Synonym Full Names
FYVE, RhoGEF and PH domain containing 2
NCBI Official Symbol
FGD2
NCBI Official Synonym Symbols
ZFYVE4
NCBI Protein Information
FYVE, RhoGEF and PH domain-containing protein 2
UniProt Protein Name
FYVE, RhoGEF and PH domain-containing protein 2
UniProt Gene Name
FGD2
UniProt Synonym Gene Names
ZFYVE4
UniProt Entry Name
FGD2_HUMAN

Uniprot Description

FGD2: an endosome and ruffle membrane-associated guanine nucleotide exchange factor (GEF) that activates CDC42, a small G protein of the Rho-subfamily. Interacts with RAB6A bound to GTP. Activates JNK1 via CDC42 but not RAC1. Recruitment to the endosome and ruffle membrane requires the presence of phosphoinositides. Binds to phosphatidylinositol 4,5- bisphosphate, phosphatidylinositol 3,4,5-trisphosphate, phosphatidylinositol 5-monophosphate, phosphatidylinositol 4- monophosphate and phosphatidylinositol 3-monophosphate. The FYVE-type zinc-finger is necessary for early endosome localization. Recruitment to endosomal membranes via this domain requires the presence of phosphatidylinositol 3-phosphate or other phosphatidylinositides. The PH domain is necessary for localization to the ruffle membrane. Recruitment to ruffle membrane occurs through binding of phosphoinositides by the PH domain. This domain also contributes to the lipid-binding properties of the protein. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, Rac/Rho

Chromosomal Location of Human Ortholog: 6p21.2

Cellular Component: cytoplasm; cytosol; Golgi apparatus; lamellipodium; ruffle

Molecular Function: guanyl-nucleotide exchange factor activity; protein binding; Rho guanyl-nucleotide exchange factor activity; small GTPase binding

Biological Process: actin cytoskeleton organization and biogenesis; cytoskeleton organization and biogenesis; filopodium formation; positive regulation of apoptosis; regulation of cell shape; regulation of GTPase activity; regulation of small GTPase mediated signal transduction

Research Articles on FGD2

Similar Products

Product Notes

The FGD2 fgd2 (Catalog #AAA1278954) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggggg caagtgagga gaagctggca tctgtgtcca acctggtcac tgtgtttgag aatagcagga ccccagaagc agcacccaga ggccagaggc tagaggacgt gcatcaccgc cctgagtgca ggcctcccga gtccccagga ccacgggaga agacgaatgt cggggaggcc gtggggtctg agcccaggac agtcagcagg aggtacctga actccctgaa gaacaagctg tccagcgaag cctggaggaa atcttgccag cctgtgaccc tctcaggatc ggggacacag gagccagaga agaagatcgt ccaggagctg ctggagacag agcaggccta tgtggcgcgc ctccacctgc tagaccaggt gtttttccag gagctgctga agacagcccg cagcagcaag gccttcccag aggatgtggt cagggtcatc ttctccaaca tctcctccat ctatcagttc cattctcagt tcttcctccc agagctgcag cggcgcctgg acgactggac agctaacccc cgcatcggtg acgtgatcca gaagctggcc cccttcctga agatgtacag tgagtatgtc aagaactttg agcgagcggc tgagctgctg gccacctgga ccgacaagtc tccactcttc caggaggttc tcactcgcat ccagagcagc gaggcttcgg gcagcctgac cctgcagcac cacatgctgg aaccagtgca gagaattcca cgttacgagc tgctgctcaa ggagtacatc cagaagctgc cagcccaggc cccagaccag gccgatgccc agaaagccct ggacatgatc ttctcagctg cccagcactc caatgcagcc atcactgaga tggagcggct gcaggacctg tgggaggtgt accagcgcct gggcctcgag gacgacatag tagacccctc taacaccctg ctccgtgagg gcccggtcct caagatctcc ttccgccgca acgaccccat ggagcgctac cttttcttgt tcaacaacat gctgctctac tgtgtgccca gggtgatcca ggtgggcgcc cagttccagg tgaggacccg catcgatgtg gccgggatga aggtgcggga gctgatggat gctgagtttc cccactcctt cctggtgtcc gggaagcagc gcaccctgga gctgcaagcc cggtcccagg aggaaatgat ttcctggatg caggccttcc aagcagccat tgaccaaatc gagaagcgga atgaaacctt caaggctgcg gcccaggggc ctgagggaga catccaggag caggagctgc agtctgagga gctgggcctc cgggcaccgc agtgggtccg ggacaagatg gtgaccatgt gcatgcgctg ccaggagccc ttcaacgctc tgacgcgccg tcgccaccac tgccgggcct gcggctatgt ggtgtgtgcc aggtgctccg actaccgggc cgaactgaaa tacgacgaca acaggcccaa ccgagtctgc ctccactgct acgcattcct cactggaaat gtgctgcctg aggccaagga ggacaagagg cggggcatcc tggagaaagg gtcctcagcc acacctgacc agagcctgat gtgcagcttc ctgcagctca tcggggacaa gtggggcaag agcggccccc ggggctggtg tgtgatccct cgggatgacc ccctcgtgct ctatgtctat gctgcccctc aggacatgag ggctcacacc tccatccccc tgctgggcta ccaggtgact gttgggcccc agggggaccc tcgggtcttc cagctacagc agtcaggcca gctctacacc ttcaaggccg agacggagga gctgaagggc cgctgggtga aggccatgga gcgggcggcc agtggctgga gccccagctg gcccaacgat ggggacctgt ccgactga. It is sometimes possible for the material contained within the vial of "FGD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.