Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FGA cdna clone

FGA cDNA Clone

Gene Names
FGA; Fib2
Synonyms
FGA; FGA cDNA Clone; FGA cdna clone
Ordering
For Research Use Only!
Sequence
atgttttccatgaggatcgtctgcctggtcctaagtgtggtgggcacagcatggactgcagatagtggtgaaggtgactttctagctgaaggaggaggcgtgcgtggcccaagggttgtggaaagacatcaatctgcctgcaaagattcagactggcccttctgctctggtgaagactggaactacaaatgcccttctggctgcaggatgaaagggttgattgatgaagtcaatcaagattttacaaacagaataaataagctcaaaaattcactatttgaatatcagaagaacaataaggattctcattcgttgaccactaatataatggaaattttgagaggcgatttttcctcagccaataaccgtgataatacctacaaccgagtgtcagaggatctgagaagcagaattgaagtcctgaagcgcaaagtcatagaaaaagttacagcaaacaatttactagtagcacgagttacaacagaggagactccacatttgaaagcaagagctataaaatggcagatgaggccggaagtgaagccgatcatgaaggaacacatagcaccaagagaggccatgctaaatctcgccctgtcagaggtatccacacttctcctttggggaagccttccctgtccccctagactaagttaa
Sequence Length
657
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,757 Da
NCBI Official Full Name
Homo sapiens fibrinogen alpha chain, mRNA
NCBI Official Synonym Full Names
fibrinogen alpha chain
NCBI Official Symbol
FGA
NCBI Official Synonym Symbols
Fib2
NCBI Protein Information
fibrinogen alpha chain
UniProt Protein Name
Fibrinogen alpha chain
Protein Family
UniProt Gene Name
FGA
UniProt Entry Name
FIBA_HUMAN

NCBI Description

This gene encodes the alpha subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Following vascular injury, the encoded preproprotein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia, afibrinogenemia and renal amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. [provided by RefSeq, Jan 2016]

Uniprot Description

FGA: Fibrinogen has a double function: yielding monomers that polymerize into fibrin and acting as a cofactor in platelet aggregation. Defects in FGA are a cause of congenital afibrinogenemia (CAFBN). This is a rare autosomal recessive disorder characterized by bleeding that varies from mild to severe and by complete absence or extremely low levels of plasma and platelet fibrinogen. The majority of cases of afibrinogenemia are due to truncating mutations. Variations in position Arg-35 (the site of cleavage of fibrinopeptide a by thrombin) leads to alpha- dysfibrinogenemias. Defects in FGA are a cause of amyloidosis type 8 (AMYL8); also known as systemic non-neuropathic amyloidosis or Ostertag-type amyloidosis. AMYL8 is a hereditary generalized amyloidosis due to deposition of apolipoprotein A1, fibrinogen and lysozyme amyloids. Viscera are particularly affected. There is no involvement of the nervous system. Clinical features include renal amyloidosis resulting in nephrotic syndrome, arterial hypertension, hepatosplenomegaly, cholestasis, petechial skin rash. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 4q28

Cellular Component: cell surface; external side of plasma membrane; extracellular region; extracellular space; fibrinogen complex; plasma membrane

Molecular Function: cell adhesion molecule binding; protein binding; receptor binding; structural molecule activity

Biological Process: blood coagulation; cell-matrix adhesion; cellular protein complex assembly; cellular protein metabolic process; extracellular matrix organization and biogenesis; fibrinolysis; induction of bacterial agglutination; plasminogen activation; platelet degranulation; positive regulation of exocytosis; positive regulation of heterotypic cell-cell adhesion; positive regulation of protein secretion; positive regulation of vasoconstriction; protein complex assembly; protein polymerization; response to calcium ion

Disease: Afibrinogenemia, Congenital; Amyloidosis, Familial Visceral; Dysfibrinogenemia, Congenital

Research Articles on FGA

Similar Products

Product Notes

The FGA fga (Catalog #AAA1275742) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttcca tgaggatcgt ctgcctggtc ctaagtgtgg tgggcacagc atggactgca gatagtggtg aaggtgactt tctagctgaa ggaggaggcg tgcgtggccc aagggttgtg gaaagacatc aatctgcctg caaagattca gactggccct tctgctctgg tgaagactgg aactacaaat gcccttctgg ctgcaggatg aaagggttga ttgatgaagt caatcaagat tttacaaaca gaataaataa gctcaaaaat tcactatttg aatatcagaa gaacaataag gattctcatt cgttgaccac taatataatg gaaattttga gaggcgattt ttcctcagcc aataaccgtg ataataccta caaccgagtg tcagaggatc tgagaagcag aattgaagtc ctgaagcgca aagtcataga aaaagttaca gcaaacaatt tactagtagc acgagttaca acagaggaga ctccacattt gaaagcaaga gctataaaat ggcagatgag gccggaagtg aagccgatca tgaaggaaca catagcacca agagaggcca tgctaaatct cgccctgtca gaggtatcca cacttctcct ttggggaagc cttccctgtc cccctagact aagttaa. It is sometimes possible for the material contained within the vial of "FGA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.