Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FES cdna clone

FES cDNA Clone

Gene Names
FES; FPS
Synonyms
FES; FES cDNA Clone; FES cdna clone
Ordering
For Research Use Only!
Sequence
atgggcttctcttctgagctgtgcagcccccagggccacggggtcctgcagcaaatgcaggaggccgagcttcgtctactggagggcatgagaaagtggatggcccagcgggtcaagagtgacagggagtatgcaggactgcttcaccacatgtccctgcaggacagtgggggccagagccgggccatcagccctgacagccccatcagtcagtcctgggctgagatcaccagccaaactgagggcctgagccgcttgctgcggcagcacgcagaggatctgaactcagggcccctgagcaagctgagcctgctcatccgggaacggcagcagcttcgcaagacctacagcgagcagtggcagcagctgcagcaggagctcaccaagacccacagccaggacattgagaagctgaagagccagtaccgagctctggcacgggacagtgcccaagccaagcgcaagtaccaggaggccagcaaagacaaggaccgtgacaaggccaaggacaagtatgtgcgcagcctgtggaagctctttgctcaccacaaccgctatgtgctgggcgtgcgggctgcgcagctacaccaccagcaccaccaccagctcctgctgcccggcctgctgcggtcactgcaggacctgcacgaggagatggcttgcatcctgaaggagatcctgcaggaatacctggagattagcagcctggtgcaggatgaggtggtggccattcaccgggagatggctgcagctgctgcccgcatccagcctgaggctgagtaccaaggcttcctgcgacagtatgggtccgcacctgacgtcccaccctgtgtcacgttcgatgagtcactgcttgaggagggtgaaccgctggagcctggggagctccagctgaacgagctgactgtggagagcgtgcagcacacgctgacctcagtgacagatgagctggctgtggccaccgagatggtgttcaggcggcaggagatggttacgcagctgcaacaggagctccggaatgaagaggagaacacccacccccgggagcgggtgcagctgctgggcaagaggcaagtgctgcaagaagcactgcaggggctgcaggtagcgctgtgcagccaggccaagctgcaggcccagcaggagttgctgcagaccaagctggagcacctgggccccggcgagcccccgcctgtgctgctcctgcaggatgaccgccactccacgtcgtcctcggagcaggagcgagaggggggaaggacacccacgctggagatccttaagagccacatctcaggaatcttccgccccaagttctcgctccctccaccgctgcagctcattccggaggtgcagaagcccctgcatgagcagctgtggtaccacggggccatcccgagggcagaggtggctgagctgctggtgcactctggggacttcctggtgcgggagagccagggcaagcaggagtacgtgctgtcggtgctgtgggatggtctgccccggcacttcatcatccagtccttggataacctgtaccgactggaaggggaaggctttcctagcattcctttgctcatcgaccacctactgagcacccagcagcccctcaccaagaagagtggtgttgtcctgcacagggctgtgcccaaggacaagtgggtgctgaaccatgaggacctggtgttgggtgagcagattggacgggggaactttggcgaagtgttcagcggacgcctgcgagccgacaacaccctggtggcggtgaagtcttgtcgagagacgctcccacctgacctcaaggccaagtttctacaggaagcgaggatcctgaagcagtacagccaccccaacatcgtgcgtctcattggtgtctgcacccagaagcagcccatctacatcgtcatggagcttgtgcaggggggcgacttcctgaccttcctccgcacggagggggcccgcctgcgggtgaagactctgctgcagatggtgggggatgcagctgctggcatggagtacctggagagcaagtgctgcatccaccgggacctggctgctcggaactgcctggtgacagagaagaatgtcctgaagatcagtgactttgggatgtcccgagaggaagccgatggggtctatgcagcctcagggggcctcagacaagtccccgtgaagtggaccgcacctgaggcccttaactacggccgctactcctccgaaagcgacgtgtggagctttggcatcttgctctgggagaccttcagcctgggggcctccccctatcccaacctcagcaatcagcagacacgggagtttgtggagaaggggggccgtctgccctgcccagagctgtgtcctgatgccgtgttcaggctcatggagcagtgctgggcctatgagcctgggcagcggcccagcttcagcaccatctaccaggagctgcagagcatccgaaagcggcatcggtga
Sequence Length
2469
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,466 Da
NCBI Official Full Name
Homo sapiens feline sarcoma oncogene, mRNA
NCBI Official Synonym Full Names
FES proto-oncogene, tyrosine kinase
NCBI Official Symbol
FES
NCBI Official Synonym Symbols
FPS
NCBI Protein Information
tyrosine-protein kinase Fes/Fps
UniProt Protein Name
Tyrosine-protein kinase Fes/Fps
UniProt Gene Name
FES
UniProt Synonym Gene Names
FPS
UniProt Entry Name
FES_HUMAN

NCBI Description

This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]

Uniprot Description

Fes: a non-receptor tyrosine kinase of the Fer family. Appears to be involved in normal hematopoiesis as well as the development of acute promyelocytic leukemia. Contains one SH2 and one FCH domain. Four LOF point mutations seen in colorectal cancer. Orthologous to v-fes from feline leukemia virus and v-fps from avian transforming virus. Mutant forms are angiogenic. Promotes survival during differentiation, and may act both to promote and inhibit tumors. May be disrupted in the t(15q+;17q-) found in acute promyelocytic leukemia, but the breakpoint does not occur within the gene.

Protein type: Oncoprotein; Protein kinase, TK; Tumor suppressor; EC 2.7.10.2; Protein kinase, tyrosine (non-receptor); Kinase, protein; TK group; Fer family

Chromosomal Location of Human Ortholog: 15q26.1

Cellular Component: cytoplasm; cytoplasmic vesicle; cytosol; extrinsic to internal side of plasma membrane; focal adhesion; microtubule cytoskeleton

Molecular Function: non-membrane spanning protein tyrosine kinase activity; phosphoinositide binding; protein binding; protein-tyrosine kinase activity

Biological Process: cell proliferation; chemotaxis; epidermal growth factor receptor signaling pathway; innate immune response; multicellular organismal development; peptidyl-tyrosine phosphorylation; positive regulation of microtubule polymerization; positive regulation of myeloid cell differentiation; protein amino acid autophosphorylation; protein amino acid phosphorylation; regulation of cell adhesion; regulation of cell differentiation; regulation of cell proliferation; regulation of cell shape; regulation of mast cell degranulation

Research Articles on FES

Similar Products

Product Notes

The FES fes (Catalog #AAA1267720) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcttct cttctgagct gtgcagcccc cagggccacg gggtcctgca gcaaatgcag gaggccgagc ttcgtctact ggagggcatg agaaagtgga tggcccagcg ggtcaagagt gacagggagt atgcaggact gcttcaccac atgtccctgc aggacagtgg gggccagagc cgggccatca gccctgacag ccccatcagt cagtcctggg ctgagatcac cagccaaact gagggcctga gccgcttgct gcggcagcac gcagaggatc tgaactcagg gcccctgagc aagctgagcc tgctcatccg ggaacggcag cagcttcgca agacctacag cgagcagtgg cagcagctgc agcaggagct caccaagacc cacagccagg acattgagaa gctgaagagc cagtaccgag ctctggcacg ggacagtgcc caagccaagc gcaagtacca ggaggccagc aaagacaagg accgtgacaa ggccaaggac aagtatgtgc gcagcctgtg gaagctcttt gctcaccaca accgctatgt gctgggcgtg cgggctgcgc agctacacca ccagcaccac caccagctcc tgctgcccgg cctgctgcgg tcactgcagg acctgcacga ggagatggct tgcatcctga aggagatcct gcaggaatac ctggagatta gcagcctggt gcaggatgag gtggtggcca ttcaccggga gatggctgca gctgctgccc gcatccagcc tgaggctgag taccaaggct tcctgcgaca gtatgggtcc gcacctgacg tcccaccctg tgtcacgttc gatgagtcac tgcttgagga gggtgaaccg ctggagcctg gggagctcca gctgaacgag ctgactgtgg agagcgtgca gcacacgctg acctcagtga cagatgagct ggctgtggcc accgagatgg tgttcaggcg gcaggagatg gttacgcagc tgcaacagga gctccggaat gaagaggaga acacccaccc ccgggagcgg gtgcagctgc tgggcaagag gcaagtgctg caagaagcac tgcaggggct gcaggtagcg ctgtgcagcc aggccaagct gcaggcccag caggagttgc tgcagaccaa gctggagcac ctgggccccg gcgagccccc gcctgtgctg ctcctgcagg atgaccgcca ctccacgtcg tcctcggagc aggagcgaga ggggggaagg acacccacgc tggagatcct taagagccac atctcaggaa tcttccgccc caagttctcg ctccctccac cgctgcagct cattccggag gtgcagaagc ccctgcatga gcagctgtgg taccacgggg ccatcccgag ggcagaggtg gctgagctgc tggtgcactc tggggacttc ctggtgcggg agagccaggg caagcaggag tacgtgctgt cggtgctgtg ggatggtctg ccccggcact tcatcatcca gtccttggat aacctgtacc gactggaagg ggaaggcttt cctagcattc ctttgctcat cgaccaccta ctgagcaccc agcagcccct caccaagaag agtggtgttg tcctgcacag ggctgtgccc aaggacaagt gggtgctgaa ccatgaggac ctggtgttgg gtgagcagat tggacggggg aactttggcg aagtgttcag cggacgcctg cgagccgaca acaccctggt ggcggtgaag tcttgtcgag agacgctccc acctgacctc aaggccaagt ttctacagga agcgaggatc ctgaagcagt acagccaccc caacatcgtg cgtctcattg gtgtctgcac ccagaagcag cccatctaca tcgtcatgga gcttgtgcag gggggcgact tcctgacctt cctccgcacg gagggggccc gcctgcgggt gaagactctg ctgcagatgg tgggggatgc agctgctggc atggagtacc tggagagcaa gtgctgcatc caccgggacc tggctgctcg gaactgcctg gtgacagaga agaatgtcct gaagatcagt gactttggga tgtcccgaga ggaagccgat ggggtctatg cagcctcagg gggcctcaga caagtccccg tgaagtggac cgcacctgag gcccttaact acggccgcta ctcctccgaa agcgacgtgt ggagctttgg catcttgctc tgggagacct tcagcctggg ggcctccccc tatcccaacc tcagcaatca gcagacacgg gagtttgtgg agaagggggg ccgtctgccc tgcccagagc tgtgtcctga tgccgtgttc aggctcatgg agcagtgctg ggcctatgag cctgggcagc ggcccagctt cagcaccatc taccaggagc tgcagagcat ccgaaagcgg catcggtga. It is sometimes possible for the material contained within the vial of "FES, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.