FERMT2 cdna clone

FERMT2 cDNA Clone

Gene Names

FERMT2; MIG2; KIND2; mig-2; UNC112; PLEKHC1; UNC112B

Synonyms

FERMT2; FERMT2 cDNA Clone; FERMT2 cdna clone

Ordering
Cat. Num. AAA1277043 For Research Use Only!

Sequence

atggctctggacgggataaggatgccagatggctgctacgcggacgggacgtgggaactgagtgtccatgtgacggacctgaaccgcgatgtcaccctgagagtgaccggcgaggtgcacattggaggcgtgatgcttaagctggtggagaaactcgatgtaaaaaaagattggtctgaccatgctctctggtgggaaaagaagagaacttggcttctgaagacacattggaccttagataagtatggtattcaggcagatgctaagcttcagttcacccctcagcacaaactgctccgcctgcagcttcccaacatgaagtatgtgaaggtgaaagtgaatttctctgatagagtcttcaaagctgtttctgacatctgtaagacttttaatatcagacaccccgaagaactttctctcttaaagaaacccagagatccaacaaagaaaaaaaagaagaagctagatgaccagtctgaagatgaggcacttgaattagaggggcctcttatcactcctggatcaggaagtatatattcaagcccaggactgtatagtaaaacaatgacccccacttatgatgctcatgatggaagccccttgtcaccaacttctgcttggtttggtgacagtgctttgtcagaaggcaatcctggtatacttgctgtcagtcaaccaatcacgtcaccagaaatcttggcaaaaatgttcaagcctcaagctcttcttgataaagcaaaaatcaaccaaggatggcttgattcctcaagatctctcatggaacaagatgtgaaggaaaatgaggccttgctgctccgattcaagtattacagcttttttgatttgaatccaaagtatgatgcaatcagaatcaatcagctttatgagcaggccaaatgggccattctcctggaagagattgaatgcacagaagaagaaatgatgatgtttgcagccctgcagtatcatatcaataagctgtcaatcatgacatcagagaatcatttgaacaacagtgacaaagaagttgatgaagttgatgctgccctttcagacctggagattactctggaagggggtaaaacgtcaacaattttgggtgacattacttccattcctgaacttgctgactacattaaagttttcaagccaaaaaagctgactctgaaaggttacaaacaatattggtgcaccttcaaagacacatccatttcttgttataagagcaaagaagaatccagtggcacaccagctcatcagatgaacctcaggggatgtgaagttaccccagatgtaaacatttcaggccaaaaatttaacattaaactcctgattccagttgcagaaggcatgaatgaaatctggcttcgttgtgacaatgaaaaacagtatgcacactggatggcagcctgcagattagcctccaaaggcaagaccatggcggacagttcttacaacttagaagttcagaatattctttcctttctgaagatgcagcatttaaacccagatcctcagttaataccagagcagatcacgactgatataactcctgaatgtttggtgtctccccgctatctaaaaaagtataagaacaagcagataacagcgagaatcttggaggcccatcagaatgtagctcagatgagtctaattgaagccaagatgagatttattcaagcttggcagtcactacctgaatttggcatcactcacttcattgcaaggttccaagggggcaaaaaagaagaacttattggaattgcatacaacagactgattcggatggatgccagcactggagatgcaattaaaacatggcgtttcagcaacatgaaacagtggaatgtcaactgggaaatcaaaatggtcaccgtagagtttgcagatgaagtacgattgtccttcatttgtactgaagtagattgcaaagtggttcatgaattcattggtggctacatatttctctcaacacgtgcaaaagaccaaaacgagagtttagatgaagagatgttctacaaacttaccagtggttgggtgtga

Sequence Length

2043

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33878545

NCBI GeneID

10979

Molecular Weight

78,675 Da

NCBI Official Full Name

Homo sapiens fermitin family homolog 2 (Drosophila), mRNA

NCBI Official Synonym Full Names

fermitin family member 2

NCBI Official Symbol

FERMT2

NCBI Official Synonym Symbols

MIG2; KIND2; mig-2; UNC112; PLEKHC1; UNC112B

NCBI Protein Information

fermitin family homolog 2

UniProt Protein Name

Fermitin family homolog 2

Protein Family

Fermitin family

UniProt Gene Name

FERMT2

UniProt Synonym Gene Names

KIND2; MIG2; PLEKHC1; MIG-2; PH domain-containing family C member 1

UniProt Entry Name

FERM2_HUMAN

Uniprot Description

kindlin-2: Participates in the connection between ECM adhesion sites and the actin cytoskeleton and also in the orchestration of actin assembly and cell shape modulation. Recruits migfilin (FBLP1) protein to cell-ECM focal adhesion sites. Belongs to the kindlin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Cytoskeletal

Chromosomal Location of Human Ortholog: 14q22.1

Cellular Component: cytoplasm; cytosol; extrinsic to internal side of plasma membrane; focal adhesion; nucleoplasm; nucleus

Molecular Function: phosphatidylinositol-3,4,5-triphosphate binding; protein binding

Biological Process: cell-matrix adhesion; focal adhesion formation; integrin activation; integrin-mediated signaling pathway; transforming growth factor beta receptor signaling pathway; Wnt receptor signaling pathway

Research Articles on FERMT2

1. The F0 domain of K2 binds actin.

Similar Products

Product Notes

The FERMT2 fermt2 (Catalog #AAA1277043) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctgg acgggataag gatgccagat ggctgctacg cggacgggac gtgggaactg agtgtccatg tgacggacct gaaccgcgat gtcaccctga gagtgaccgg cgaggtgcac attggaggcg tgatgcttaa gctggtggag aaactcgatg taaaaaaaga ttggtctgac catgctctct ggtgggaaaa gaagagaact tggcttctga agacacattg gaccttagat aagtatggta ttcaggcaga tgctaagctt cagttcaccc ctcagcacaa actgctccgc ctgcagcttc ccaacatgaa gtatgtgaag gtgaaagtga atttctctga tagagtcttc aaagctgttt ctgacatctg taagactttt aatatcagac accccgaaga actttctctc ttaaagaaac ccagagatcc aacaaagaaa aaaaagaaga agctagatga ccagtctgaa gatgaggcac ttgaattaga ggggcctctt atcactcctg gatcaggaag tatatattca agcccaggac tgtatagtaa aacaatgacc cccacttatg atgctcatga tggaagcccc ttgtcaccaa cttctgcttg gtttggtgac agtgctttgt cagaaggcaa tcctggtata cttgctgtca gtcaaccaat cacgtcacca gaaatcttgg caaaaatgtt caagcctcaa gctcttcttg ataaagcaaa aatcaaccaa ggatggcttg attcctcaag atctctcatg gaacaagatg tgaaggaaaa tgaggccttg ctgctccgat tcaagtatta cagctttttt gatttgaatc caaagtatga tgcaatcaga atcaatcagc tttatgagca ggccaaatgg gccattctcc tggaagagat tgaatgcaca gaagaagaaa tgatgatgtt tgcagccctg cagtatcata tcaataagct gtcaatcatg acatcagaga atcatttgaa caacagtgac aaagaagttg atgaagttga tgctgccctt tcagacctgg agattactct ggaagggggt aaaacgtcaa caattttggg tgacattact tccattcctg aacttgctga ctacattaaa gttttcaagc caaaaaagct gactctgaaa ggttacaaac aatattggtg caccttcaaa gacacatcca tttcttgtta taagagcaaa gaagaatcca gtggcacacc agctcatcag atgaacctca ggggatgtga agttacccca gatgtaaaca tttcaggcca aaaatttaac attaaactcc tgattccagt tgcagaaggc atgaatgaaa tctggcttcg ttgtgacaat gaaaaacagt atgcacactg gatggcagcc tgcagattag cctccaaagg caagaccatg gcggacagtt cttacaactt agaagttcag aatattcttt cctttctgaa gatgcagcat ttaaacccag atcctcagtt aataccagag cagatcacga ctgatataac tcctgaatgt ttggtgtctc cccgctatct aaaaaagtat aagaacaagc agataacagc gagaatcttg gaggcccatc agaatgtagc tcagatgagt ctaattgaag ccaagatgag atttattcaa gcttggcagt cactacctga atttggcatc actcacttca ttgcaaggtt ccaagggggc aaaaaagaag aacttattgg aattgcatac aacagactga ttcggatgga tgccagcact ggagatgcaa ttaaaacatg gcgtttcagc aacatgaaac agtggaatgt caactgggaa atcaaaatgg tcaccgtaga gtttgcagat gaagtacgat tgtccttcat ttgtactgaa gtagattgca aagtggttca tgaattcatt ggtggctaca tatttctctc aacacgtgca aaagaccaaa acgagagttt agatgaagag atgttctaca aacttaccag tggttgggtg tga. It is sometimes possible for the material contained within the vial of "FERMT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

FERMT2 cdna clone