FDXR cdna clone
FDXR cDNA Clone
Gene Names
FDXR; ADXR
Synonyms
FDXR; FDXR cDNA Clone; FDXR cdna clone
Sequence
atggcttcgcgctgctggcgctggtggggctggtcggcgtggcctcggacccggctgcctcccgccgggagcaccccgagcttctgccaccatttctccacacaggagaagaccccccagatctgtgtggtgggcagtggcccagctggcttctacacggcccaacacctgctaaagcacccccaggcccacgtggacatctacgagaaacagcctgtgccctttggcctggtgcgctttggtgtggcgcctgatcaccccgaggtgaagaatgtcatcaacacatttacccagacggcccattctggccgctgtgccttctggggcaacgtggaggtgggcagggacgtgacggtgccggagctgcgggaggcctaccacgctgtggtgctgagctacggggcagaggaccatcgggccctggaaattcctggtgaggagctgccaggtgtgtgctccgcccgggccttcgtgggctggtacaacgggcttcctgagaaccaggagctggagccagacctgagctgtgacacagccgtgattctggggcaggggaacgtggctctggacgtggcccgcatcctactgaccccacctgagcacctggagagaacggacatcacgaaggcagccctgggtgtactgaggcagagtcgagtgaagacagtgtggctagtgggccggcgtggacccctgcaagtggccttcaccattaaggagcttcgggagatgattcagttaccgggagcccggcccattttggatcctgtggatttcttgggtctccaggacaagatcaaggaggtcccccgcccgaggaagcggctgacggaactgctgcttcgaacggccacagagaagccagggccggcggaagctgcccgccaggcatcggcctcccgtgcctggggcctccgctttttccgaagcccccagcaggtgctgccctcaccagatgggcggcgggcagcaggtgtccgcctagcagtcactagactggagggtgtcgatgaggccacccgtgcagtgcccacgggagacatggaagacctcccttgtgggctggtgctcagcagcattgggtataagagccgccctgtcgacccaagcgtgccctttgactccaagcttggggtcatccccaatgtggagggccgggttatggatgtgccaggcctctactgcagcggctgggtgaagagaggacctacaggtgtcatagccacaaccatgactgacagcttcctcaccggccagatgctgctgcaggacctgaaggctgggttgctcccctctggccccaggcctggctacgcagccatccaggccctgctcagcagccgaggggtccggccagtctctttctcagactgggagaagctggatgccgaggaggtggcccggggccagggcacggggaagcccagggagaagctggtggatcctcaggagatgctgcgcctcctgggccactga
Sequence Length
1476
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
57,370 Da
NCBI Official Full Name
Homo sapiens ferredoxin reductase, mRNA
NCBI Official Synonym Full Names
ferredoxin reductase
NCBI Official Symbol
FDXR
NCBI Official Synonym Symbols
ADXR
NCBI Protein Information
NADPH:adrenodoxin oxidoreductase, mitochondrial
UniProt Protein Name
NADPH:adrenodoxin oxidoreductase, mitochondrial
UniProt Gene Name
FDXR
UniProt Synonym Gene Names
ADXR; AR; Adrenodoxin reductase; Ferredoxin reductase
UniProt Entry Name
ADRO_HUMAN
NCBI Description
This gene encodes a mitochondrial flavoprotein that initiates electron transport for cytochromes P450 receiving electrons from NADPH. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
Uniprot Description
FDXR: Serves as the first electron transfer protein in all the mitochondrial P450 systems. Including cholesterol side chain cleavage in all steroidogenic tissues, steroid 11-beta hydroxylation in the adrenal cortex, 25-OH-vitamin D3-24 hydroxylation in the kidney, and sterol C-27 hydroxylation in the liver. Belongs to the ferredoxin--NADP reductase type 1 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 1.18.1.6; Mitochondrial; Oxidoreductase
Chromosomal Location of Human Ortholog: 17q25.1
Cellular Component: mitochondrial matrix; mitochondrion
Molecular Function: ferredoxin-NADP+ reductase activity; NADPH-adrenodoxin reductase activity; protein binding
Biological Process: C21-steroid hormone biosynthetic process; generation of precursor metabolites and energy; steroid biosynthetic process; sterol metabolic process
Research Articles on FDXR
Similar Products
Product Notes
The FDXR fdxr (Catalog #AAA1274814) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcgc gctgctggcg ctggtggggc tggtcggcgt ggcctcggac ccggctgcct cccgccggga gcaccccgag cttctgccac catttctcca cacaggagaa gaccccccag atctgtgtgg tgggcagtgg cccagctggc ttctacacgg cccaacacct gctaaagcac ccccaggccc acgtggacat ctacgagaaa cagcctgtgc cctttggcct ggtgcgcttt ggtgtggcgc ctgatcaccc cgaggtgaag aatgtcatca acacatttac ccagacggcc cattctggcc gctgtgcctt ctggggcaac gtggaggtgg gcagggacgt gacggtgccg gagctgcggg aggcctacca cgctgtggtg ctgagctacg gggcagagga ccatcgggcc ctggaaattc ctggtgagga gctgccaggt gtgtgctccg cccgggcctt cgtgggctgg tacaacgggc ttcctgagaa ccaggagctg gagccagacc tgagctgtga cacagccgtg attctggggc aggggaacgt ggctctggac gtggcccgca tcctactgac cccacctgag cacctggaga gaacggacat cacgaaggca gccctgggtg tactgaggca gagtcgagtg aagacagtgt ggctagtggg ccggcgtgga cccctgcaag tggccttcac cattaaggag cttcgggaga tgattcagtt accgggagcc cggcccattt tggatcctgt ggatttcttg ggtctccagg acaagatcaa ggaggtcccc cgcccgagga agcggctgac ggaactgctg cttcgaacgg ccacagagaa gccagggccg gcggaagctg cccgccaggc atcggcctcc cgtgcctggg gcctccgctt tttccgaagc ccccagcagg tgctgccctc accagatggg cggcgggcag caggtgtccg cctagcagtc actagactgg agggtgtcga tgaggccacc cgtgcagtgc ccacgggaga catggaagac ctcccttgtg ggctggtgct cagcagcatt gggtataaga gccgccctgt cgacccaagc gtgccctttg actccaagct tggggtcatc cccaatgtgg agggccgggt tatggatgtg ccaggcctct actgcagcgg ctgggtgaag agaggaccta caggtgtcat agccacaacc atgactgaca gcttcctcac cggccagatg ctgctgcagg acctgaaggc tgggttgctc ccctctggcc ccaggcctgg ctacgcagcc atccaggccc tgctcagcag ccgaggggtc cggccagtct ctttctcaga ctgggagaag ctggatgccg aggaggtggc ccggggccag ggcacgggga agcccaggga gaagctggtg gatcctcagg agatgctgcg cctcctgggc cactga. It is sometimes possible for the material contained within the vial of "FDXR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
