Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCN1 cdna clone

FCN1 cDNA Clone

Gene Names
FCN1; FCNM
Synonyms
FCN1; FCN1 cDNA Clone; FCN1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctgagtggagccaccatggcccggggtctcgctgtcctgctagtcttgttcctgcatatcaagaacctgcctgcccaggctgcggacacatgtccagaggtgaaggtggtgggcctggagggctctgacaagctcaccattctccgaggctgcccggggctgcccggggccccagggccaaagggagaggcaggtgtcattggagagagaggagaacgcggtctccctggagcccctggaaaggcaggaccagtggggcccaaaggagaccgaggagagaaggggatgcgtggagagaaaggagacgctgggcagtctcagtcgtgtgcgacaggcccacgcaactgcaaggacctgctagaccgggggtatttcctgagcggctggcacaccatctacctgcccgactgccggcccctgactgtgctctgtgacatggacacggacggagggggctggaccgttttccagcggaggatggatggctctgtggacttctatcgggactgggccgcatacaagcagggcttcggcagtcagctgggggagttctggctggggaacgacaacatccacgccctgactgcccagggaagcagcgagctccgtgtagacctggtggactttgagggcaaccaccagtttgctaagtacaaatcattcaaggtggctgacgaggcagagaagtacaagctggtactgggagcctttgtcgggggcagtgcgggtaattctctaacgggccacaacaacaacttcttctccaccaaagaccaagacaatgatgtgagttcttcgaattgtgctgagaagttccagggagcctggtggtacgccgactgtcatgcttcaaacctcaatggtctctacctcatgggaccccatgagagctatgccaatggtatcaactggagtgcggcgaaggggtacaaatatagctacaaggtgtcagagatgaaggtgcggcccgcctag
Sequence Length
981
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,078 Da
NCBI Official Full Name
Homo sapiens ficolin (collagen/fibrinogen domain containing) 1, mRNA
NCBI Official Synonym Full Names
ficolin 1
NCBI Official Symbol
FCN1
NCBI Official Synonym Symbols
FCNM
NCBI Protein Information
ficolin-1
UniProt Protein Name
Ficolin-1
Protein Family
UniProt Gene Name
FCN1
UniProt Synonym Gene Names
FCNM
UniProt Entry Name
FCN1_HUMAN

NCBI Description

The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]

Uniprot Description

FCN1: Complement-activating lectin and pattern recognition receptor. Binds GlcNAc. Binds preferentially to 9-O-acetylated 2- 6-linked sialic acid derivatives and to various glycans containing sialic acid engaged in a 2-3 linkage. Belongs to the ficolin lectin family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 9q34

Cellular Component: extracellular region; extrinsic to external side of plasma membrane

Molecular Function: G-protein-coupled receptor binding; pattern recognition receptor activity; protein binding; serine-type endopeptidase activity; sialic acid binding

Biological Process: cell surface pattern recognition receptor signaling pathway; complement activation; complement activation, lectin pathway; G-protein coupled receptor protein signaling pathway; negative regulation of virion penetration into host cell; recognition of apoptotic cell

Research Articles on FCN1

Similar Products

Product Notes

The FCN1 fcn1 (Catalog #AAA1268659) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctga gtggagccac catggcccgg ggtctcgctg tcctgctagt cttgttcctg catatcaaga acctgcctgc ccaggctgcg gacacatgtc cagaggtgaa ggtggtgggc ctggagggct ctgacaagct caccattctc cgaggctgcc cggggctgcc cggggcccca gggccaaagg gagaggcagg tgtcattgga gagagaggag aacgcggtct ccctggagcc cctggaaagg caggaccagt ggggcccaaa ggagaccgag gagagaaggg gatgcgtgga gagaaaggag acgctgggca gtctcagtcg tgtgcgacag gcccacgcaa ctgcaaggac ctgctagacc gggggtattt cctgagcggc tggcacacca tctacctgcc cgactgccgg cccctgactg tgctctgtga catggacacg gacggagggg gctggaccgt tttccagcgg aggatggatg gctctgtgga cttctatcgg gactgggccg catacaagca gggcttcggc agtcagctgg gggagttctg gctggggaac gacaacatcc acgccctgac tgcccaggga agcagcgagc tccgtgtaga cctggtggac tttgagggca accaccagtt tgctaagtac aaatcattca aggtggctga cgaggcagag aagtacaagc tggtactggg agcctttgtc gggggcagtg cgggtaattc tctaacgggc cacaacaaca acttcttctc caccaaagac caagacaatg atgtgagttc ttcgaattgt gctgagaagt tccagggagc ctggtggtac gccgactgtc atgcttcaaa cctcaatggt ctctacctca tgggacccca tgagagctat gccaatggta tcaactggag tgcggcgaag gggtacaaat atagctacaa ggtgtcagag atgaaggtgc ggcccgccta g. It is sometimes possible for the material contained within the vial of "FCN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.