Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCGR3B cdna clone

FCGR3B cDNA Clone

Gene Names
FCGR3B; CD16; FCG3; CD16b; FCGR3; FCR-10; FCRIII; FCRIIIb
Synonyms
FCGR3B; FCGR3B cDNA Clone; FCGR3B cdna clone
Ordering
For Research Use Only!
Sequence
ATGTGGCAGCTGCTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACAGTGGTTTCACAATGAGAGCCTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGTCAACGACAGTGGAGAGTACAGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTCCATATCGGCTGGCTGTTGCTCCAGGCCCCTCGGTGGGTGTTCAAGGAGGAAGACCCTATTCACCTGAGGTGTCACAGCTGGAAGAACACTGCTCTGCATAAGGTCACATATTTACAGAATGGCAAAGACAGGAAGTATTTTCATCATAATTCTGACTTCCACATTCCAAAAGCCACACTCAAAGATAGCGGCTCCTACTTCTGCAGGGGGCTTGTTGGGAGTAAAAATGTGTCTTCAGAGACTGTGAACATCACCATCACTCAAGGTTTGGCAGTGTCAACCATCTCATCATTCTCTCCACCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTTTTTGCAGTGGACACAGGACTATATTTCTCTGTGAAGACAAACATTTGA
Sequence Length
702
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,216 Da
NCBI Official Full Name
Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b), mRNA
NCBI Official Synonym Full Names
Fc fragment of IgG receptor IIIb
NCBI Official Symbol
FCGR3B
NCBI Official Synonym Symbols
CD16; FCG3; CD16b; FCGR3; FCR-10; FCRIII; FCRIIIb
NCBI Protein Information
low affinity immunoglobulin gamma Fc region receptor III-B
UniProt Protein Name
Low affinity immunoglobulin gamma Fc region receptor III-B
UniProt Gene Name
FCGR3B
UniProt Synonym Gene Names
CD16B; FCG3; FCGR3; IGFR3; Fc-gamma RIII; Fc-gamma RIIIb; FcRIII; FcRIIIb
UniProt Entry Name
FCG3B_HUMAN

NCBI Description

The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012]

Uniprot Description

Receptor for the Fc region of immunoglobulins gamma. Low affinity receptor. Binds complexed or aggregated IgG and also monomeric IgG. Contrary to III-A, is not capable to mediate antibody-dependent cytotoxicity and phagocytosis. May serve as a trap for immune complexes in the peripheral circulation which does not activate neutrophils.

Research Articles on FCGR3B

Similar Products

Product Notes

The FCGR3B fcgr3b (Catalog #AAA1277326) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTGGCAGC TGCTCCTCCC AACTGCTCTG CTACTTCTAG TTTCAGCTGG CATGCGGACT GAAGATCTCC CAAAGGCTGT GGTGTTCCTG GAGCCTCAAT GGTACAGCGT GCTTGAGAAG GACAGTGTGA CTCTGAAGTG CCAGGGAGCC TACTCCCCTG AGGACAATTC CACACAGTGG TTTCACAATG AGAGCCTCAT CTCAAGCCAG GCCTCGAGCT ACTTCATTGA CGCTGCCACA GTCAACGACA GTGGAGAGTA CAGGTGCCAG ACAAACCTCT CCACCCTCAG TGACCCGGTG CAGCTAGAAG TCCATATCGG CTGGCTGTTG CTCCAGGCCC CTCGGTGGGT GTTCAAGGAG GAAGACCCTA TTCACCTGAG GTGTCACAGC TGGAAGAACA CTGCTCTGCA TAAGGTCACA TATTTACAGA ATGGCAAAGA CAGGAAGTAT TTTCATCATA ATTCTGACTT CCACATTCCA AAAGCCACAC TCAAAGATAG CGGCTCCTAC TTCTGCAGGG GGCTTGTTGG GAGTAAAAAT GTGTCTTCAG AGACTGTGAA CATCACCATC ACTCAAGGTT TGGCAGTGTC AACCATCTCA TCATTCTCTC CACCTGGGTA CCAAGTCTCT TTCTGCTTGG TGATGGTACT CCTTTTTGCA GTGGACACAG GACTATATTT CTCTGTGAAG ACAAACATTT GA. It is sometimes possible for the material contained within the vial of "FCGR3B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.