Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCGR2B cdna clone

FCGR2B cDNA Clone

Gene Names
FCGR2B; CD32; FCG2; CD32B; FCGR2; IGFR2
Synonyms
FCGR2B; FCGR2B cDNA Clone; FCGR2B cdna clone
Ordering
For Research Use Only!
Sequence
atgggaatcctgtcattcttacctgtccttgccactgagagtgactgggctgactgcaagtccccccagccttggggtcatatgcttctgtggacagctgtgctattcctggctcctgttgctgggacacctgcagctcccccaaaggctgtgctgaaactcgagccccagtggatcaacgtgctccaggaggactctgtgactctgacatgccgggggactcacagccctgagagcgactccattcagtggttccacaatgggaatctcattcccacccacacgcagcccagctacaggttcaaggccaacaacaatgacagcggggagtacacgtgccagactggccagaccagcctcagcgaccctgtgcatctgactgtgctttctgagtggctggtgctccagacccctcacctggagttccaggagggagaaaccatcgtgctgaggtgccacagctggaaggacaagcctctggtcaaggtcacattcttccagaatggaaaatccaagaaattttcccgttcggatcccaacttctccatcccacaagcaaaccacagtcacagtggtgattaccactgcacaggaaacataggctacacgctgtactcatccaagcctgtgaccatcactgtccaagctcccagctcttcaccgatggggatcattgtggctgtggtcactgggattgctgtagcggccattgttgctgctgtagtggccttgatctactgcaggaaaaagcggatttcagctctcccaggataccctgagtgcagggaaatgggagagaccctccctgagaaaccagccaatcccactaatcctgatgaggctgacaaagttggggctgagaacacaatcacctattcacttctcatgcacccggatgctctggaagagcctgatgaccagaaccgtatttag
Sequence Length
933
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,450 Da
NCBI Official Full Name
Homo sapiens Fc fragment of IgG, low affinity IIb, receptor (CD32), mRNA
NCBI Official Synonym Full Names
Fc fragment of IgG receptor IIb
NCBI Official Symbol
FCGR2B
NCBI Official Synonym Symbols
CD32; FCG2; CD32B; FCGR2; IGFR2
NCBI Protein Information
low affinity immunoglobulin gamma Fc region receptor II-b
UniProt Protein Name
Low affinity immunoglobulin gamma Fc region receptor II-b
UniProt Gene Name
FCGR2B
UniProt Synonym Gene Names
CD32; FCG2; IGFR2; IgG Fc receptor II-b; Fc-gamma-RIIb; FcRII-b
UniProt Entry Name
FCG2B_HUMAN

NCBI Description

The protein encoded by this gene is a low affinity receptor for the Fc region of immunoglobulin gamma complexes. The encoded protein is involved in the phagocytosis of immune complexes and in the regulation of antibody production by B-cells. Variations in this gene may increase susceptibilty to systemic lupus erythematosus (SLE). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Uniprot Description

FCGR2B: a transmembrane receptor for the Fc region of complexed or aggregated immunoglobulin gamma (IgG). Involved in a variety of effector and regulatory functions such as phagocytosis of immune complexes and modulation of antibody production by B-cells. Binding to this receptor results in down modulation of previous state of cell activation triggered via antigen receptors on B cells, T cells or via another Fc receptor. Three splice-variant isoforms have been observed.

Protein type: Cell surface; Membrane protein, integral; Oncoprotein

Chromosomal Location of Human Ortholog: 1q23

Cellular Component: plasma membrane

Molecular Function: protein binding

Biological Process: immune response; regulation of immune response; signal transduction

Disease: Malaria, Susceptibility To; Systemic Lupus Erythematosus

Research Articles on FCGR2B

Similar Products

Product Notes

The FCGR2B fcgr2b (Catalog #AAA1271938) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaatcc tgtcattctt acctgtcctt gccactgaga gtgactgggc tgactgcaag tccccccagc cttggggtca tatgcttctg tggacagctg tgctattcct ggctcctgtt gctgggacac ctgcagctcc cccaaaggct gtgctgaaac tcgagcccca gtggatcaac gtgctccagg aggactctgt gactctgaca tgccggggga ctcacagccc tgagagcgac tccattcagt ggttccacaa tgggaatctc attcccaccc acacgcagcc cagctacagg ttcaaggcca acaacaatga cagcggggag tacacgtgcc agactggcca gaccagcctc agcgaccctg tgcatctgac tgtgctttct gagtggctgg tgctccagac ccctcacctg gagttccagg agggagaaac catcgtgctg aggtgccaca gctggaagga caagcctctg gtcaaggtca cattcttcca gaatggaaaa tccaagaaat tttcccgttc ggatcccaac ttctccatcc cacaagcaaa ccacagtcac agtggtgatt accactgcac aggaaacata ggctacacgc tgtactcatc caagcctgtg accatcactg tccaagctcc cagctcttca ccgatgggga tcattgtggc tgtggtcact gggattgctg tagcggccat tgttgctgct gtagtggcct tgatctactg caggaaaaag cggatttcag ctctcccagg ataccctgag tgcagggaaa tgggagagac cctccctgag aaaccagcca atcccactaa tcctgatgag gctgacaaag ttggggctga gaacacaatc acctattcac ttctcatgca cccggatgct ctggaagagc ctgatgacca gaaccgtatt tag. It is sometimes possible for the material contained within the vial of "FCGR2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.