Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCGR2A cdna clone

FCGR2A cDNA Clone

Gene Names
FCGR2A; CD32; FCG2; FcGR; CD32A; CDw32; FCGR2; IGFR2; FCGR2A1
Synonyms
FCGR2A; FCGR2A cDNA Clone; FCGR2A cdna clone
Ordering
For Research Use Only!
Sequence
atgactatggagacccaaatgtctcagaatgtatgtcccagaaacctgtggctgcttcaaccattgacagttttgctgctgctggcttctgcagacagtcaagctgctcccccaaaggctgtgctgaaacttgagcccccgtggatcaacgtgctccaggaggactctgtgactctgacatgccagggggctcgcagccctgagagcgactccattcagtggttccacaatgggaatctcattcccacccacacgcagcccagctacaggttcaaggccaacaacaatgacagcggggagtacacgtgccagactggccagaccagcctcagcgaccctgtgcatctgactgtgctttccgaatggctggtgctccagacccctcacctggagttccaggagggagaaaccatcatgctgaggtgccacagctggaaggacaagcctctggtcaaggtcacattcttccagaatggaaaatcccagaaattctcccatttggatcccaccttctccatcccacaagcaaaccacagtcacagtggtgattaccactgcacaggaaacataggctacacgctgttctcatccaagcctgtgaccatcactgtccaagtgcccagcatgggcagctcttcaccaatgggggtcattgtggctgtggtcattgcgactgctgtagcagccattgttgctgctgtagtggccttgatctactgcaggaaaaagcggatttcagccaattccactgatcctgtgaaggctgcccaatttgagccacctggacgtcaaatgattgccatcagaaagagacaacttgaagaaaccaacaatgactatgaaacagctgacggcggctacatgactctgaaccccagggcacctactgacgatgataaaaacatctacctgactcttcctcccaacgaccatgtcaacagtaataactaa
Sequence Length
951
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,930 Da
NCBI Official Full Name
Homo sapiens Fc fragment of IgG, low affinity IIa, receptor (CD32), mRNA
NCBI Official Synonym Full Names
Fc fragment of IgG receptor IIa
NCBI Official Symbol
FCGR2A
NCBI Official Synonym Symbols
CD32; FCG2; FcGR; CD32A; CDw32; FCGR2; IGFR2; FCGR2A1
NCBI Protein Information
low affinity immunoglobulin gamma Fc region receptor II-a
UniProt Protein Name
Low affinity immunoglobulin gamma Fc region receptor II-a
UniProt Gene Name
FCGR2A
UniProt Synonym Gene Names
CD32; FCG2; FCGR2A1; IGFR2; IgG Fc receptor II-a; Fc-gamma-RIIa; FcRII-a
UniProt Entry Name
FCG2A_HUMAN

NCBI Description

This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]

Uniprot Description

FCGR2A: low affinity receptor for the Fc region of IgGs. Binding to IgG initiates cellular responses against pathogens and soluble antigens. A type I membrane protein found on monocytes, neutrophils and platelets. SHP-1 associates with this protein to modulate signaling events in myeloid cells.

Protein type: Receptor, misc.; Cell surface; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q23

Cellular Component: plasma membrane

Molecular Function: protein binding

Disease: Malaria, Susceptibility To; Systemic Lupus Erythematosus

Research Articles on FCGR2A

Similar Products

Product Notes

The FCGR2A fcgr2a (Catalog #AAA1270101) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactatgg agacccaaat gtctcagaat gtatgtccca gaaacctgtg gctgcttcaa ccattgacag ttttgctgct gctggcttct gcagacagtc aagctgctcc cccaaaggct gtgctgaaac ttgagccccc gtggatcaac gtgctccagg aggactctgt gactctgaca tgccaggggg ctcgcagccc tgagagcgac tccattcagt ggttccacaa tgggaatctc attcccaccc acacgcagcc cagctacagg ttcaaggcca acaacaatga cagcggggag tacacgtgcc agactggcca gaccagcctc agcgaccctg tgcatctgac tgtgctttcc gaatggctgg tgctccagac ccctcacctg gagttccagg agggagaaac catcatgctg aggtgccaca gctggaagga caagcctctg gtcaaggtca cattcttcca gaatggaaaa tcccagaaat tctcccattt ggatcccacc ttctccatcc cacaagcaaa ccacagtcac agtggtgatt accactgcac aggaaacata ggctacacgc tgttctcatc caagcctgtg accatcactg tccaagtgcc cagcatgggc agctcttcac caatgggggt cattgtggct gtggtcattg cgactgctgt agcagccatt gttgctgctg tagtggcctt gatctactgc aggaaaaagc ggatttcagc caattccact gatcctgtga aggctgccca atttgagcca cctggacgtc aaatgattgc catcagaaag agacaacttg aagaaaccaa caatgactat gaaacagctg acggcggcta catgactctg aaccccaggg cacctactga cgatgataaa aacatctacc tgactcttcc tcccaacgac catgtcaaca gtaataacta a. It is sometimes possible for the material contained within the vial of "FCGR2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.