Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FCGR1A cdna clone

FCGR1A cDNA Clone

Gene Names
FCGR1A; CD64; FCRI; CD64A; IGFR1
Synonyms
FCGR1A; FCGR1A cDNA Clone; FCGR1A cdna clone
Ordering
For Research Use Only!
Sequence
atgtggttcttgacaactctgctcctttgggttccagttgatgggcaagtggacaccacaaaggcagtgatcactttgcagcctccatgggtcagcgtgttccaagaggaaaccgtaaccttgcattgtgaggtgctccatctgcctgggagcagctctacacagtggtttctcaatggcacagccactcagacctcgacccccagctacagaatcacctctgccagtgtcaatgacagtggtgaatacaggtgccagagaggtctctcagggcgaagtgaccccatacagctggaaatccacagaggctggctactactgcaggtctccagcagagtcttcacggaaggagaacctctggccttgaggtgtcatgcgtggaaggataagctggtgtacaatgtgctttactatcgaaatggcaaagcctttaagtttttccactggaattctaacctcaccattctgaaaaccaacataagtcacaatggcacctaccattgctcaggcatgggaaagcatcgctacacatcagcaggaatatctgtcactgtgaaagagctatttccagctccagtgctgaatgcatctgtgacatccccactcctggaggggaatctggtcaccctgagctgtgaaacaaagttgctcttgcagaggcctggtttgcagctttacttctccttctacatgggcagcaagaccctgcgaggcaggaacacatcctctgaataccaaatactaactgctagaagagaagactctgggttatactggtgcgaggctgccacagaggatggaaatgtccttaagcgcagccctgagttggagcttcaagtgcttggcctccagttaccaactcctgtctggtttcatgtccttttctatctggcagtgggaataatgtttttagtgaacactgttctctgggtgacaatacgtaaagaactgaaaagaaagaaaaagtgggatttagaaatctctttggattctggtcatgagaagaaggtaatttccagccttcaagaagacagacatttagaagaagagctgaaatgtcaggaacaaaaagaagaacagctgcaggaaggggtgcaccggaaggagccccagggggccacgtag
Sequence Length
1125
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,795 Da
NCBI Official Full Name
Homo sapiens Fc fragment of IgG, high affinity Ia, receptor (CD64), mRNA
NCBI Official Synonym Full Names
Fc fragment of IgG receptor Ia
NCBI Official Symbol
FCGR1A
NCBI Official Synonym Symbols
CD64; FCRI; CD64A; IGFR1
NCBI Protein Information
high affinity immunoglobulin gamma Fc receptor I
UniProt Protein Name
High affinity immunoglobulin gamma Fc receptor I
UniProt Gene Name
FCGR1A
UniProt Synonym Gene Names
FCG1; FCGR1; IGFR1; IgG Fc receptor I; FcRI; FcgammaRIa
UniProt Entry Name
FCGR1_HUMAN

NCBI Description

This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]

Uniprot Description

FCGR1A: High affinity receptor for the Fc region of immunoglobulins gamma. Functions in both innate and adaptive immune responses. Belongs to the immunoglobulin superfamily. FCGR1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Receptor, misc.

Chromosomal Location of Human Ortholog: 1q21.2-q21.3

Cellular Component: early endosome membrane; plasma membrane

Molecular Function: protein binding; receptor signaling protein activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; immune response; phagocytosis, engulfment; receptor-mediated endocytosis; regulation of immune response; signal transduction

Research Articles on FCGR1A

Similar Products

Product Notes

The FCGR1A fcgr1a (Catalog #AAA1268190) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggttct tgacaactct gctcctttgg gttccagttg atgggcaagt ggacaccaca aaggcagtga tcactttgca gcctccatgg gtcagcgtgt tccaagagga aaccgtaacc ttgcattgtg aggtgctcca tctgcctggg agcagctcta cacagtggtt tctcaatggc acagccactc agacctcgac ccccagctac agaatcacct ctgccagtgt caatgacagt ggtgaataca ggtgccagag aggtctctca gggcgaagtg accccataca gctggaaatc cacagaggct ggctactact gcaggtctcc agcagagtct tcacggaagg agaacctctg gccttgaggt gtcatgcgtg gaaggataag ctggtgtaca atgtgcttta ctatcgaaat ggcaaagcct ttaagttttt ccactggaat tctaacctca ccattctgaa aaccaacata agtcacaatg gcacctacca ttgctcaggc atgggaaagc atcgctacac atcagcagga atatctgtca ctgtgaaaga gctatttcca gctccagtgc tgaatgcatc tgtgacatcc ccactcctgg aggggaatct ggtcaccctg agctgtgaaa caaagttgct cttgcagagg cctggtttgc agctttactt ctccttctac atgggcagca agaccctgcg aggcaggaac acatcctctg aataccaaat actaactgct agaagagaag actctgggtt atactggtgc gaggctgcca cagaggatgg aaatgtcctt aagcgcagcc ctgagttgga gcttcaagtg cttggcctcc agttaccaac tcctgtctgg tttcatgtcc ttttctatct ggcagtggga ataatgtttt tagtgaacac tgttctctgg gtgacaatac gtaaagaact gaaaagaaag aaaaagtggg atttagaaat ctctttggat tctggtcatg agaagaaggt aatttccagc cttcaagaag acagacattt agaagaagag ctgaaatgtc aggaacaaaa agaagaacag ctgcaggaag gggtgcaccg gaaggagccc cagggggcca cgtag. It is sometimes possible for the material contained within the vial of "FCGR1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.