Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXW5 cdna clone

FBXW5 cDNA Clone

Gene Names
FBXW5; Fbw5
Synonyms
FBXW5; FBXW5 cDNA Clone; FBXW5 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgagggcggcacgcccctgctccccgacagcctggtctaccagatcttcctgagcctgggcccggccgacgtgctggccgccgggctggtgtgccgccaatggcaggccgtgtcgcgggacgagttcctgtggagggagcagttctaccgctactaccaggtggcccgcgacgtgccccgacacccagcggccatgtcctggtacgaggagttccagcggctgtatgacacggtgccctgcgtggaggtgcagacgctgcgggaacacacagaccaggtcctgcacctcagcttctcccattccgggtaccagttcgcgtcctgctccaaggactgcactgtgaagatctggagcaacgacctgaccatctcgctgctgcacagcgcggacatgcggccctacaactggagctacacccagttctcccagttcaacaaggacgactcgctactgctggcctcgggggtgttcctggggccgcacaactcctcatccggcgagattgctgtcatcagcctagactccttcgcgctgctgtcccgcgtgcggaacaagccctatgacgtgtttggctgttggctcaccgagaccagcctcatctcggggaacctgcaccgcatcggagatatcacctcctgctcggtgctgtggctcaacaatgccttccaggatgtggagtcagagaacgtcaacgtggtgaagcggctgttcaagatccagaacctcaatgccagcaccgtccgcacggtgatggtggccgactgcagccgcttcgacagccctgacctgctgctggaagccggtgacccggccacgtccccctgccgcatctttgacctgggcagcgacaacgaggaggtggtggctggcccggcccccgcccacgccaaggagggcttgcggcactttctggaccgcgtgctggaggggcgggcgcagccacagctgtcggagcgcatgctagagaccaaggtggccgagctgctggcccagggccacaccaagccacccgagcgcagtgccacaggcgccaagagcaagtacctcatcttcaccactggctgcctcacctactccccacaccagatcggcatcaagcagatcctgccacaccagatgaccacggcagggcccgtgctgggtgagggccggggctccgatgccttcttcgacgcgctggaccacgtcatagacatacacggacacatcatcggcatgggcctgtcgcccgacaacaggtacctgtacgtgaacagccgcgcctggcccaacggtgcggtggtggccgaccccatgcagccgccaccaatcgcggaggagattgacctgctggtgttcgacctcaagaccatgcgggaggtgaggcgggctctgcgtgcgcaccgcgcctacacgcccaacgacgagtgcttcttcatcttcctggacgtcagcagggacttcgtggccagcggggcggaggaccggcacggctacatctgggaccgccactacaacatctgtctggccaggctgcggcacgaggatgtggtcaactcagtggtcttcagtccccaggagcaggagctgctgctcacggccagcgacgacgccaccatcaaagcctggcgctccccacgcaccatgcgcgtcctccaggcacctcgcccacggcctcgcaccttcttctcctggcttgccagccagaggcgctga
Sequence Length
1701
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,185 Da
NCBI Official Full Name
Homo sapiens F-box and WD repeat domain containing 5, mRNA
NCBI Official Synonym Full Names
F-box and WD repeat domain containing 5
NCBI Official Symbol
FBXW5
NCBI Official Synonym Symbols
Fbw5
NCBI Protein Information
F-box/WD repeat-containing protein 5
UniProt Protein Name
F-box/WD repeat-containing protein 5
UniProt Gene Name
FBXW5
UniProt Synonym Gene Names
FBW5
UniProt Entry Name
FBXW5_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented. [provided by RefSeq, Jul 2008]

Uniprot Description

FBXW5: Substrate recognition component of both SCF (SKP1-CUL1- F-box protein) and DCX (DDB1-CUL4-X-box) E3 ubiquitin-protein ligase complexes. Substrate recognition component of the SCF(FBXW5) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of SASS6 during S phase, leading to prevent centriole reduplication. Substrate-specific adapter of the DCX(FBXW5) E3 ubiquitin-protein ligase complex which mediates the polyubiquitination and subsequent degradation of TSC2. May also act as a negative regulator of MAP3K7/TAK1 signaling in the interleukin-1B (IL1B) signaling pathway. Belongs to the FBXW5 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 9q34.3

Cellular Component: cytoplasm; SCF ubiquitin ligase complex

Molecular Function: protein binding; protein kinase binding

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process

Research Articles on FBXW5

Similar Products

Product Notes

The FBXW5 fbxw5 (Catalog #AAA1275235) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgagg gcggcacgcc cctgctcccc gacagcctgg tctaccagat cttcctgagc ctgggcccgg ccgacgtgct ggccgccggg ctggtgtgcc gccaatggca ggccgtgtcg cgggacgagt tcctgtggag ggagcagttc taccgctact accaggtggc ccgcgacgtg ccccgacacc cagcggccat gtcctggtac gaggagttcc agcggctgta tgacacggtg ccctgcgtgg aggtgcagac gctgcgggaa cacacagacc aggtcctgca cctcagcttc tcccattccg ggtaccagtt cgcgtcctgc tccaaggact gcactgtgaa gatctggagc aacgacctga ccatctcgct gctgcacagc gcggacatgc ggccctacaa ctggagctac acccagttct cccagttcaa caaggacgac tcgctactgc tggcctcggg ggtgttcctg gggccgcaca actcctcatc cggcgagatt gctgtcatca gcctagactc cttcgcgctg ctgtcccgcg tgcggaacaa gccctatgac gtgtttggct gttggctcac cgagaccagc ctcatctcgg ggaacctgca ccgcatcgga gatatcacct cctgctcggt gctgtggctc aacaatgcct tccaggatgt ggagtcagag aacgtcaacg tggtgaagcg gctgttcaag atccagaacc tcaatgccag caccgtccgc acggtgatgg tggccgactg cagccgcttc gacagccctg acctgctgct ggaagccggt gacccggcca cgtccccctg ccgcatcttt gacctgggca gcgacaacga ggaggtggtg gctggcccgg cccccgccca cgccaaggag ggcttgcggc actttctgga ccgcgtgctg gaggggcggg cgcagccaca gctgtcggag cgcatgctag agaccaaggt ggccgagctg ctggcccagg gccacaccaa gccacccgag cgcagtgcca caggcgccaa gagcaagtac ctcatcttca ccactggctg cctcacctac tccccacacc agatcggcat caagcagatc ctgccacacc agatgaccac ggcagggccc gtgctgggtg agggccgggg ctccgatgcc ttcttcgacg cgctggacca cgtcatagac atacacggac acatcatcgg catgggcctg tcgcccgaca acaggtacct gtacgtgaac agccgcgcct ggcccaacgg tgcggtggtg gccgacccca tgcagccgcc accaatcgcg gaggagattg acctgctggt gttcgacctc aagaccatgc gggaggtgag gcgggctctg cgtgcgcacc gcgcctacac gcccaacgac gagtgcttct tcatcttcct ggacgtcagc agggacttcg tggccagcgg ggcggaggac cggcacggct acatctggga ccgccactac aacatctgtc tggccaggct gcggcacgag gatgtggtca actcagtggt cttcagtccc caggagcagg agctgctgct cacggccagc gacgacgcca ccatcaaagc ctggcgctcc ccacgcacca tgcgcgtcct ccaggcacct cgcccacggc ctcgcacctt cttctcctgg cttgccagcc agaggcgctg a. It is sometimes possible for the material contained within the vial of "FBXW5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.