FBXL17 cdna clone
FBXL17 cDNA Clone
Gene Names
FBXL17; Fbl17; Fbx13; FBXO13
Synonyms
FBXL17; FBXL17 cDNA Clone; FBXL17 cdna clone
Sequence
atgtctgataatggcgtatgtgttttagcatttaaatgtcctggacttcttaggtatacagcctacaggtgtaaacagctttctgacacctctattattgcggttgcctctcactgtcctttacttcagaaagtgcatgtaggcaaccaggacaaactcactgatgaaggactcaagcagctgggctcaaaatgcagagaactcaaagatattcatttcggccagtgttacaagatctcagatgaaggcatgatcgtcatagctaagggctgtctgaaattacaaaggatatacatgcaggaaaacaaattagtgacagatcagtcagtgaaagcatttgctgaacactgtcctgagcttcaatatgtaggcttcatgggttgttcagtcacttctaaaggagtcattcacctaaccaagctaagaaacctttccagcttggacctacgtcatatcactgaactggataatgaaaccgtgatggaaattgtcaagaggtgcaaaaatcttagctctctcaatctctgtctgaactggatcataaatgacaggtgtgtggaggtcattgcaaaggaaggacaaaacctgaaagagctatatttggtgtcctgtaaaatcacagattatgcactgatagccattgggcgatacagcatgacaatagagactgtggatgtcggatggtgtaaagaaatcacagaccaaggagccaccctgattgcacagagcagcaagtctctgagatatttggggctgatgagatgtgataaagtcaacgaagtgacggtggaacagctggtgcagcagtacccccacatcaccttcagcaccgtcctgcaggactgcaagaggaccttggagagagcctatcagatgggctggacccccaacatgtctgccgcctcctcctag
Sequence Length
912
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,451 Da
NCBI Official Full Name
Homo sapiens F-box and leucine-rich repeat protein 17, mRNA
NCBI Official Synonym Full Names
F-box and leucine rich repeat protein 17
NCBI Official Symbol
FBXL17
NCBI Official Synonym Symbols
Fbl17; Fbx13; FBXO13
NCBI Protein Information
F-box/LRR-repeat protein 17
UniProt Protein Name
F-box/LRR-repeat protein 17
Protein Family
UniProt Gene Name
FBXL17
UniProt Synonym Gene Names
FBL17; FBX13; FBXO13
UniProt Entry Name
FXL17_HUMAN
NCBI Description
Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Uniprot Description
FBXL17: Substrate-recognition component of the SCF (SKP1-CUL1-F- box protein)-type E3 ubiquitin ligase complex. 3 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 5q21.3
Research Articles on FBXL17
Similar Products
Product Notes
The FBXL17 fbxl17 (Catalog #AAA1277467) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgata atggcgtatg tgttttagca tttaaatgtc ctggacttct taggtataca gcctacaggt gtaaacagct ttctgacacc tctattattg cggttgcctc tcactgtcct ttacttcaga aagtgcatgt aggcaaccag gacaaactca ctgatgaagg actcaagcag ctgggctcaa aatgcagaga actcaaagat attcatttcg gccagtgtta caagatctca gatgaaggca tgatcgtcat agctaagggc tgtctgaaat tacaaaggat atacatgcag gaaaacaaat tagtgacaga tcagtcagtg aaagcatttg ctgaacactg tcctgagctt caatatgtag gcttcatggg ttgttcagtc acttctaaag gagtcattca cctaaccaag ctaagaaacc tttccagctt ggacctacgt catatcactg aactggataa tgaaaccgtg atggaaattg tcaagaggtg caaaaatctt agctctctca atctctgtct gaactggatc ataaatgaca ggtgtgtgga ggtcattgca aaggaaggac aaaacctgaa agagctatat ttggtgtcct gtaaaatcac agattatgca ctgatagcca ttgggcgata cagcatgaca atagagactg tggatgtcgg atggtgtaaa gaaatcacag accaaggagc caccctgatt gcacagagca gcaagtctct gagatatttg gggctgatga gatgtgataa agtcaacgaa gtgacggtgg aacagctggt gcagcagtac ccccacatca ccttcagcac cgtcctgcag gactgcaaga ggaccttgga gagagcctat cagatgggct ggacccccaa catgtctgcc gcctcctcct ag. It is sometimes possible for the material contained within the vial of "FBXL17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
