Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FANCM cdna clone

FANCM cDNA Clone

Gene Names
FANCM; FAAP250; KIAA1596
Synonyms
FANCM; FANCM cDNA Clone; FANCM cdna clone
Ordering
For Research Use Only!
Sequence
atgagcggacggcaaagaacgctttttcagacgtggggctcaagtatctcccgatcatctgggactccgggttgcagctccggaactgagcgacctcagagccctggcagctccaaggcgcctttgccagcagcagcggaggctcagctggagtcggacgatgatgtgttgcttgtcgcggcgtacgaggctgagcggcagttgtgtctagagaatggcgggttctgcacctccgcgggcgccctgtggatttaccctaccaattgcccagtgcgggactaccagctgcacatttcccgggctgctctgttttgcaatacgctggtgtgtctgcctaccggactgggaaagacctttattgccgccgtggtcatgtacaatttctaccgctggttcccttcaggaaaggtggtcttcatggccccaacgaaacccttggtgacacagcagatcgaggcttgctaccaggtgatgggtatcccgcaatcccacatggccgaaatgacagggtctacacaagcttccaccaggaaggaaatatggtgcagtaagagagtgctttttcttacacctcaggtcatggtaaatgacctttctagaggagcttgtcccgctgctgaaataaagtgtttagttattgatgaagctcataaagctctcggaaactatgcttattgccaggttgtaagagaactagtcaaatatacaaatcactttagaatcttggctctaagtgccacaccaggtagtgatataaaggctgtgcaacaagttattactaacctgctaattgggcagatagagcttcgttctgaagattctccagatattttgacatattctcatgaaagaaaagttgaaaagcttattgttccgcttggtgaagaacttgcagccatccaaaagacctatatccagattttggaatcatttgctcgttctttgattcagaggaatgttttgatgagaagggatatcccaaatctaacaaaatatcagataattctggcaagagatcagtttaggaaaaacccatctccgaatattgtgggaatacaacaaggcataatcgagggagagtttgctatttgtattagtttatatcatggttatgaattattgcagcaaatgggaatgagatcattatatttcttcctttgtggaattatggatggaactaaagggatgacacggtcaaaaaatgaacttggccgaaatgaagacttcatgaaactctataatcatctagagtgtatgtttgcacgtacacgtagtacttcagcaaatggtatttctgctatccaacaaggagataaaaataaaaaatttgtttatagtcatccaaagttaaagaaattagaagaagttgtaattgaacacttcaagtcatggaatgctgaaaacactactgaaaagaaacgtgatgagacccgagttatgatcttctcttcatttcgagatagtgttcaagaaattgcagaaatgctttcacagcatcagccaattattagagtaatgacttttgtcggccatgcctcagggaaaagcacgaagggttttacccagaaggagcaactggaggtagtgaaacagtttcgtgacggtggttacaacacgctggtttctacctgtgtgggtgaagaaggtttggatataggagaagttgatcttataatatgttttgattcccagaagagcccaattcgtcttgtacaacgaatgggtagaactggccgtaaacgtcaaggcaggatagttattatcctttctgaaggacgagaggaacgtatttataatcagagtcagtccaacaaaagaagtatatataaagctatttcaagtaacaggcaggtccttcatttttaccaaagaagtccacgaatggttcctgatggaatcaacccaaaattacacaaaatgttcatcacacatggtgtctatgaaccagagaagccttctcggaacttgcagcgaaagtcatctatcttttcctatagggatggtaaataa
Sequence Length
2010
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
229,281 Da
NCBI Official Full Name
Homo sapiens Fanconi anemia, complementation group M, mRNA
NCBI Official Synonym Full Names
Fanconi anemia complementation group M
NCBI Official Symbol
FANCM
NCBI Official Synonym Symbols
FAAP250; KIAA1596
NCBI Protein Information
Fanconi anemia group M protein
UniProt Protein Name
Fanconi anemia group M protein
UniProt Gene Name
FANCM
UniProt Synonym Gene Names
KIAA1596; Protein FACM; FAAP250
UniProt Entry Name
FANCM_HUMAN

NCBI Description

The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Uniprot Description

FANCM: ATPase required for FANCD2 ubiquitination, a key reaction in DNA repair. Binds to ssDNA but not to dsDNA. Recruited to forks stalled by DNA interstrand cross-links, and required for cellular resistance to such lesions. Defects in FANCM are a cause of Fanconi anemia complementation group M (FANCM). FANCM is a disorder affecting all bone marrow elements and resulting in anemia, leukopenia and thrombopenia. It is associated with cardiac, renal and limb malformations, dermal pigmentary changes, and a predisposition to the development of malignancies. At the cellular level it is associated with hypersensitivity to DNA-damaging agents, chromosomal instability (increased chromosome breakage) and defective DNA repair. Belongs to the DEAD box helicase family. DEAH subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 14q21.2

Cellular Component: nucleoplasm

Molecular Function: chromatin binding; protein binding

Biological Process: replication fork processing; resolution of meiotic joint molecules as recombinants

Disease: Fanconi Anemia, Complementation Group M; Tracheoesophageal Fistula With Or Without Esophageal Atresia

Research Articles on FANCM

Similar Products

Product Notes

The FANCM fancm (Catalog #AAA1273849) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcggac ggcaaagaac gctttttcag acgtggggct caagtatctc ccgatcatct gggactccgg gttgcagctc cggaactgag cgacctcaga gccctggcag ctccaaggcg cctttgccag cagcagcgga ggctcagctg gagtcggacg atgatgtgtt gcttgtcgcg gcgtacgagg ctgagcggca gttgtgtcta gagaatggcg ggttctgcac ctccgcgggc gccctgtgga tttaccctac caattgccca gtgcgggact accagctgca catttcccgg gctgctctgt tttgcaatac gctggtgtgt ctgcctaccg gactgggaaa gacctttatt gccgccgtgg tcatgtacaa tttctaccgc tggttccctt caggaaaggt ggtcttcatg gccccaacga aacccttggt gacacagcag atcgaggctt gctaccaggt gatgggtatc ccgcaatccc acatggccga aatgacaggg tctacacaag cttccaccag gaaggaaata tggtgcagta agagagtgct ttttcttaca cctcaggtca tggtaaatga cctttctaga ggagcttgtc ccgctgctga aataaagtgt ttagttattg atgaagctca taaagctctc ggaaactatg cttattgcca ggttgtaaga gaactagtca aatatacaaa tcactttaga atcttggctc taagtgccac accaggtagt gatataaagg ctgtgcaaca agttattact aacctgctaa ttgggcagat agagcttcgt tctgaagatt ctccagatat tttgacatat tctcatgaaa gaaaagttga aaagcttatt gttccgcttg gtgaagaact tgcagccatc caaaagacct atatccagat tttggaatca tttgctcgtt ctttgattca gaggaatgtt ttgatgagaa gggatatccc aaatctaaca aaatatcaga taattctggc aagagatcag tttaggaaaa acccatctcc gaatattgtg ggaatacaac aaggcataat cgagggagag tttgctattt gtattagttt atatcatggt tatgaattat tgcagcaaat gggaatgaga tcattatatt tcttcctttg tggaattatg gatggaacta aagggatgac acggtcaaaa aatgaacttg gccgaaatga agacttcatg aaactctata atcatctaga gtgtatgttt gcacgtacac gtagtacttc agcaaatggt atttctgcta tccaacaagg agataaaaat aaaaaatttg tttatagtca tccaaagtta aagaaattag aagaagttgt aattgaacac ttcaagtcat ggaatgctga aaacactact gaaaagaaac gtgatgagac ccgagttatg atcttctctt catttcgaga tagtgttcaa gaaattgcag aaatgctttc acagcatcag ccaattatta gagtaatgac ttttgtcggc catgcctcag ggaaaagcac gaagggtttt acccagaagg agcaactgga ggtagtgaaa cagtttcgtg acggtggtta caacacgctg gtttctacct gtgtgggtga agaaggtttg gatataggag aagttgatct tataatatgt tttgattccc agaagagccc aattcgtctt gtacaacgaa tgggtagaac tggccgtaaa cgtcaaggca ggatagttat tatcctttct gaaggacgag aggaacgtat ttataatcag agtcagtcca acaaaagaag tatatataaa gctatttcaa gtaacaggca ggtccttcat ttttaccaaa gaagtccacg aatggttcct gatggaatca acccaaaatt acacaaaatg ttcatcacac atggtgtcta tgaaccagag aagccttctc ggaacttgca gcgaaagtca tctatctttt cctataggga tggtaaataa. It is sometimes possible for the material contained within the vial of "FANCM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.