FAM64A cdna clone
FAM64A cDNA Clone
Gene Names
FAM64A; CATS; RCS1
Synonyms
FAM64A; FAM64A cDNA Clone; FAM64A cdna clone
Sequence
atggcttctcggtggcagaacatggggacctccgtgcgccggagatctctccagcaccaggagcagctggaggacagcaaggagctgcagcctgtggtcagccatcaggagacctctgtaggggccctggggtccctgtgcagacagttccaaaggaggctgcccctgagagccgtcaacctcaacctccgcgcagggccctcctggaaacgcctggaaaccccagagccaggtcagcagggcctccaggctgcagctcgctcagctaagagtgctttgggtgccgtgtcccagagaatccaggagtcctgccaaagtggcaccaagtggctggtggagacccaggtgaaggccaggaggcggaagagaggagcacagaagggcagtggatccccaactcacagcctgagccagaagagcacccggctgtctggagccgcccctgcccactcagccgcagacccctgggagaaggagcatcaccgcctctctgtccggatgggctcacatgcccacccattacggcgatcaaggcgggaggctgccttccggagcccctactcctcaacagagcccctctgctctcccagcgagtctgacagtgacctagagcctgtgggggcgggaattcagcatctccagaagctgtcccaagagctagatgaagccattatggcggaagagaggaaacaagccctgtctgaccgccaaggcttcatactcaaggatgtctatgcttccccgtga
Sequence Length
747
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,242 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 64, member A, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 64 member A
NCBI Official Symbol
FAM64A
NCBI Official Synonym Symbols
CATS; RCS1
NCBI Protein Information
protein FAM64A
UniProt Protein Name
Protein FAM64A
Protein Family
UniProt Gene Name
FAM64A
UniProt Synonym Gene Names
CATS; RCS1
UniProt Entry Name
FA64A_HUMAN
Uniprot Description
FAM64A: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell cycle regulation; Nucleolus
Chromosomal Location of Human Ortholog: 17p13.2
Cellular Component: cytoplasm; nucleolus; nucleus
Molecular Function: protein binding
Research Articles on FAM64A
Similar Products
Product Notes
The FAM64A fam64a (Catalog #AAA1273580) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttctc ggtggcagaa catggggacc tccgtgcgcc ggagatctct ccagcaccag gagcagctgg aggacagcaa ggagctgcag cctgtggtca gccatcagga gacctctgta ggggccctgg ggtccctgtg cagacagttc caaaggaggc tgcccctgag agccgtcaac ctcaacctcc gcgcagggcc ctcctggaaa cgcctggaaa ccccagagcc aggtcagcag ggcctccagg ctgcagctcg ctcagctaag agtgctttgg gtgccgtgtc ccagagaatc caggagtcct gccaaagtgg caccaagtgg ctggtggaga cccaggtgaa ggccaggagg cggaagagag gagcacagaa gggcagtgga tccccaactc acagcctgag ccagaagagc acccggctgt ctggagccgc ccctgcccac tcagccgcag acccctggga gaaggagcat caccgcctct ctgtccggat gggctcacat gcccacccat tacggcgatc aaggcgggag gctgccttcc ggagccccta ctcctcaaca gagcccctct gctctcccag cgagtctgac agtgacctag agcctgtggg ggcgggaatt cagcatctcc agaagctgtc ccaagagcta gatgaagcca ttatggcgga agagaggaaa caagccctgt ctgaccgcca aggcttcata ctcaaggatg tctatgcttc cccgtga. It is sometimes possible for the material contained within the vial of "FAM64A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
