Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM46A cdna clone

FAM46A cDNA Clone

Gene Names
FAM46A; XTP11; C6orf37
Synonyms
FAM46A; FAM46A cDNA Clone; FAM46A cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagggtgaagggtacttcgccatgtctgaggacgagctggcctgcagcccctacatccccctaggcggcgacttcggcggcggcgacttcggcggcggcgacttcggcggcggcgacttcggcggcggcgacttcggcggtggcggcagcttcggtgggcattgcttggactattgcgaaagccctacggcgcactgcaatgtgctgaactgggagcaagtgcagcggctggacggcatcctgagcgagaccattccgattcacgggcgcggcaacttccccacgctcgagctgcagccgagcctgatcgtgaaggtggtgcggcggcgcctggccgagaagcgcattggcgtccgcgacgtgcgcctcaacggctcggcagccagccatgtcctgcaccaggacagcggcctgggctacaaggacctggacctcatcttctgcgccgacctgcgcggggaaggggagtttcagactgtgaaggacgtcgtgctggactgcctgttggacttcttacccgagggggtgaacaaagagaagatcacaccactcacgctcaaggaagcttatgtgcagaaaatggttaaagtgtgcaatgactctgaccgatggagtcttatatccctgtcaaacaacagtggcaaaaatgtggaactgaaatttgtggattccctccggaggcagtttgaattcagtgtagattcttttcaaatcaaattagactctcttctgctcttttatgaatgttcagagaacccaatgactgagacatttcaccccacaataatcggggagagcgtctatggcgatttccaggaagcctttgatcacctttgtaacaagatcattgccaccaggaacccagaggaaatccgagggggaggcctgcttaagtactgcaacctcttggtgaggggctttaggcccgcctctgatgaaatcaagacccttcaaaggtatatgtgttccaggtttttcatcgacttctcagacattggagagcagcagagaaaactggagtcctatttgcagaaccactttgtgggattggaagaccgcaagtatgagtatctcatgacccttcatggagtggtaaatgagagcacagtgtgcctgatgggacatgaaagaagacagactttaaaccttatcaccatgctggctatccgggtgttagctgaccaaaatgtcattcctaatgtggctaatgtcacttgctattaccagccagccccctatgtagcagatgccaactttagcaattactacattgcacaggttcagccagtattcacgtgccagcaacagacctactccacttggctaccctgcaattaa
Sequence Length
1344
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,943 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 46, member A, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 46 member A
NCBI Official Symbol
FAM46A
NCBI Official Synonym Symbols
XTP11; C6orf37
NCBI Protein Information
protein FAM46A
UniProt Protein Name
Protein FAM46A
Protein Family
UniProt Gene Name
FAM46A
UniProt Synonym Gene Names
C6orf37; XTP11
UniProt Entry Name
FA46A_HUMAN

Uniprot Description

FAM46A: Belongs to the FAM46 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 6q14

Molecular Function: protein binding

Biological Process: regulation of blood coagulation; regulation of gene expression

Research Articles on FAM46A

Similar Products

Product Notes

The FAM46A fam46a (Catalog #AAA1268020) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg gtgaagggta cttcgccatg tctgaggacg agctggcctg cagcccctac atccccctag gcggcgactt cggcggcggc gacttcggcg gcggcgactt cggcggcggc gacttcggcg gcggcgactt cggcggtggc ggcagcttcg gtgggcattg cttggactat tgcgaaagcc ctacggcgca ctgcaatgtg ctgaactggg agcaagtgca gcggctggac ggcatcctga gcgagaccat tccgattcac gggcgcggca acttccccac gctcgagctg cagccgagcc tgatcgtgaa ggtggtgcgg cggcgcctgg ccgagaagcg cattggcgtc cgcgacgtgc gcctcaacgg ctcggcagcc agccatgtcc tgcaccagga cagcggcctg ggctacaagg acctggacct catcttctgc gccgacctgc gcggggaagg ggagtttcag actgtgaagg acgtcgtgct ggactgcctg ttggacttct tacccgaggg ggtgaacaaa gagaagatca caccactcac gctcaaggaa gcttatgtgc agaaaatggt taaagtgtgc aatgactctg accgatggag tcttatatcc ctgtcaaaca acagtggcaa aaatgtggaa ctgaaatttg tggattccct ccggaggcag tttgaattca gtgtagattc ttttcaaatc aaattagact ctcttctgct cttttatgaa tgttcagaga acccaatgac tgagacattt caccccacaa taatcgggga gagcgtctat ggcgatttcc aggaagcctt tgatcacctt tgtaacaaga tcattgccac caggaaccca gaggaaatcc gagggggagg cctgcttaag tactgcaacc tcttggtgag gggctttagg cccgcctctg atgaaatcaa gacccttcaa aggtatatgt gttccaggtt tttcatcgac ttctcagaca ttggagagca gcagagaaaa ctggagtcct atttgcagaa ccactttgtg ggattggaag accgcaagta tgagtatctc atgacccttc atggagtggt aaatgagagc acagtgtgcc tgatgggaca tgaaagaaga cagactttaa accttatcac catgctggct atccgggtgt tagctgacca aaatgtcatt cctaatgtgg ctaatgtcac ttgctattac cagccagccc cctatgtagc agatgccaac tttagcaatt actacattgc acaggttcag ccagtattca cgtgccagca acagacctac tccacttggc taccctgcaa ttaa. It is sometimes possible for the material contained within the vial of "FAM46A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.