FAM45B cdna clone
FAM45B cDNA Clone
Gene Names
FAM45BP; HT011; FAM45B
Synonyms
FAM45B; FAM45B cDNA Clone; FAM45B cdna clone
Sequence
atggctgcggccgagttggcggacactcagctgatgcttggagtcgggctgatcgaaaaggacacaaatggagaagttctgtgggtgtggtgttatccttccacgacagccacattaaggaacctgctgctgagaaaatgctgccttacagatgaaaacaaacttctccatccctttgtctttggtcagtacagaagaacatggttttatatcacaataattgaagttccagattcttccattttgaaaaaggtgactcatttttctattgtcctgaccgccaaagattttaacccagagaagtatgctgccttcactaggatattgtgtagaatgtacctgaaacatgggagcccagttaaaatgatggagagttatattgcagttctcacaaaggggatatgccagagtgaagaaaacggctctttccttagtaaggattttgatgcccgaaaggcctacccggctggctccatcaaagacattgtatctcagtttggaatggaaactgttatcttacacacagcactgatgctaaagaaaagaattgtggtgtatcaccccaagatagaagcggtccaggagttcaccaggactctgcctgccctggtgtggcaccgacaggactggaccatccttcactcttacgtgcacctcaacgccgatgagctggaagccctgcagatgtgcacaggttacgtcgctggatttgtagacttggaggtgagcaacagaccagacctctatgatgtgtttgtgaatctggcagagagtgagattaccattgctccccttgcaaaagaggccatggcaatgggtaaactgcacaaagaaatgggtcagctaattgttcagtctgcagaagatccagagaaatcagagagccaggttatacaggatattgctctaaaaacaagagaaatctttaccaacctagcaccgttttcagaagtttcggctgatggagaaaagagagtccttaatttggaggcgctaaagcaaaaacgatttccaccagcaacagaaaacttcctttatcatctagcagcagccgaacaaatgctgaaaatctga
Sequence Length
1074
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
40,514 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 45, member B, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 45 member B, pseudogene
NCBI Official Symbol
FAM45BP
NCBI Official Synonym Symbols
HT011; FAM45B
UniProt Protein Name
Putative protein FAM45B
UniProt Gene Name
FAM45BP
UniProt Entry Name
FA45B_HUMAN
Uniprot Description
FAM45B: Belongs to the FAM45 family.
Chromosomal Location of Human Ortholog: Xq26.1
Similar Products
Product Notes
The FAM45B fam45bp (Catalog #AAA1276826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcgg ccgagttggc ggacactcag ctgatgcttg gagtcgggct gatcgaaaag gacacaaatg gagaagttct gtgggtgtgg tgttatcctt ccacgacagc cacattaagg aacctgctgc tgagaaaatg ctgccttaca gatgaaaaca aacttctcca tccctttgtc tttggtcagt acagaagaac atggttttat atcacaataa ttgaagttcc agattcttcc attttgaaaa aggtgactca tttttctatt gtcctgaccg ccaaagattt taacccagag aagtatgctg ccttcactag gatattgtgt agaatgtacc tgaaacatgg gagcccagtt aaaatgatgg agagttatat tgcagttctc acaaagggga tatgccagag tgaagaaaac ggctctttcc ttagtaagga ttttgatgcc cgaaaggcct acccggctgg ctccatcaaa gacattgtat ctcagtttgg aatggaaact gttatcttac acacagcact gatgctaaag aaaagaattg tggtgtatca ccccaagata gaagcggtcc aggagttcac caggactctg cctgccctgg tgtggcaccg acaggactgg accatccttc actcttacgt gcacctcaac gccgatgagc tggaagccct gcagatgtgc acaggttacg tcgctggatt tgtagacttg gaggtgagca acagaccaga cctctatgat gtgtttgtga atctggcaga gagtgagatt accattgctc cccttgcaaa agaggccatg gcaatgggta aactgcacaa agaaatgggt cagctaattg ttcagtctgc agaagatcca gagaaatcag agagccaggt tatacaggat attgctctaa aaacaagaga aatctttacc aacctagcac cgttttcaga agtttcggct gatggagaaa agagagtcct taatttggag gcgctaaagc aaaaacgatt tccaccagca acagaaaact tcctttatca tctagcagca gccgaacaaa tgctgaaaat ctga. It is sometimes possible for the material contained within the vial of "FAM45B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
