FAM18B2 cdna clone
FAM18B2 cDNA Clone
Gene Names
TVP23C; FAM18B2
Synonyms
FAM18B2; FAM18B2 cDNA Clone; FAM18B2 cdna clone
Sequence
atgttgcagcaggatagtaatgatgacactgaagctgtttcactgtttgatgcggaagaggagacgactaatagaccaagaaaagccaaaatcagacatccagtagcatcgtttttccacttattctttcgagtcagtgcaatcatcgtctgtcttctctgtgagttgctcagcagcagctttattacctgtatggttacaattatcttgttgttgtcgtgtgacttttgggcagtgaagaatgtcacaggtagactaatggttggcctacgttggtggaatcacattgatgaagatggaaagagccattgggtgtttgaatctagaaaggagtcctctcaagagaataaaactgtgtcagaggctgaatcaagaatcttttggttgggacttattgcctgttcagtactgtgggtgatatttgcctttagtgcactcttctccttcacagtaaagtggctgagacggtctcgccacattgcccagactggtctgaaagtcttgggctcaagagatcctcccgcttccgccttccaaagcgctgggataacaggcgtgagccgctgcccgggccatccctcgagtaagtttcatcaggtagacattaattctttcacgaggatcacggatcgagctctttactggaaacctgcgccccgccttagttctccacctcttcgtgcggctccaggcaactgccaacagatggcgcccgcccgcctatttctctccttgcggctttgggcctggaggggaggtggggagagtcccaatagcagaggaactggtgagcccgggccaaaatttcatctggcatccggaatgcattaa
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,454 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 18, member B2, mRNA
NCBI Official Synonym Full Names
trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)
NCBI Official Symbol
TVP23C
NCBI Official Synonym Symbols
FAM18B2
NCBI Protein Information
Golgi apparatus membrane protein TVP23 homolog C
UniProt Protein Name
Golgi apparatus membrane protein TVP23 homolog C
UniProt Gene Name
TVP23C
UniProt Synonym Gene Names
FAM18B2
UniProt Entry Name
TV23C_HUMAN
Uniprot Description
TVP23C: Belongs to the FAM18/TVP23 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 17p12
Cellular Component: integral to Golgi membrane
Biological Process: protein secretion; vesicle-mediated transport
Research Articles on FAM18B2
Similar Products
Product Notes
The FAM18B2 tvp23c (Catalog #AAA1273837) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgcagc aggatagtaa tgatgacact gaagctgttt cactgtttga tgcggaagag gagacgacta atagaccaag aaaagccaaa atcagacatc cagtagcatc gtttttccac ttattctttc gagtcagtgc aatcatcgtc tgtcttctct gtgagttgct cagcagcagc tttattacct gtatggttac aattatcttg ttgttgtcgt gtgacttttg ggcagtgaag aatgtcacag gtagactaat ggttggccta cgttggtgga atcacattga tgaagatgga aagagccatt gggtgtttga atctagaaag gagtcctctc aagagaataa aactgtgtca gaggctgaat caagaatctt ttggttggga cttattgcct gttcagtact gtgggtgata tttgccttta gtgcactctt ctccttcaca gtaaagtggc tgagacggtc tcgccacatt gcccagactg gtctgaaagt cttgggctca agagatcctc ccgcttccgc cttccaaagc gctgggataa caggcgtgag ccgctgcccg ggccatccct cgagtaagtt tcatcaggta gacattaatt ctttcacgag gatcacggat cgagctcttt actggaaacc tgcgccccgc cttagttctc cacctcttcg tgcggctcca ggcaactgcc aacagatggc gcccgcccgc ctatttctct ccttgcggct ttgggcctgg aggggaggtg gggagagtcc caatagcaga ggaactggtg agcccgggcc aaaatttcat ctggcatccg gaatgcatta a. It is sometimes possible for the material contained within the vial of "FAM18B2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
