Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM108A1 cdna clone

FAM108A1 cDNA Clone

Gene Names
ABHD17A; C19orf27; FAM108A1
Synonyms
FAM108A1; FAM108A1 cDNA Clone; FAM108A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgggctgtcgctgagtgagctctgctgcctcttctgctgcccgccctgccccggccgcatcgctgccaagctcgccttcctgccgccggaggccacctactccctggtgcctgagcccgagccggggcctggtggggccggggccgcccccttggggaccctgagagcctcctcgggcgcacccgggcgctggaagctgcacctgacggagcgtgccgacttccagtacagccagcgcgagctggacaccatcgaggtcttccccaccaagagcgcccgcggcaaccgcgtctcctgcatgtatgttcgctgcgtgcctggtgccagacaaggacaccaggctcagggaggccatccccagctggcatgggtgggcaggctgggcgactccaacaacccagcgcctggtggttgcctgctgggcgagagctggggcacaggggctgccctggcctgcgggtacatccaccttctcgccaggtacacggtcctcttctcgcacggcaatgccgtggacctgggccagatgagcagcttctacattggcctgggctcccgcctccactgcaacatcttctcctacgactactccggctacggtgccagctcgggcaggccttccgagaggaacctctatgccgacatcgacgccgcctggcaggccctgcgcaccaggtacggcatcagcccggacagcatcatcctgtacgggcagagcatcggcacggtgcccaccgtggacctggcctcgcgctacgagtgtgccgcggtggtgctgcactcgccgctcacctcgggcatgcgcgtcgccttccccgacaccaagaagacctactgcttcgacgccttccctaacatcgagaaggtgtccaagatcacgtctcccgtgctcatcatccacggcacggaggacgaggtgatcgacttctcgcacgggctggcgctctacgagcgctgccccaaggcggtggagccgctgtgggtggagggcgccgggcacaacgacatcgagctctacagccagtacctggagcgcctgcgtcgcttcatctcccaggagctgcccagccagcgcgcctag
Sequence Length
1086
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,048 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 108, member A1, mRNA
NCBI Official Synonym Full Names
abhydrolase domain containing 17A
NCBI Official Symbol
ABHD17A
NCBI Official Synonym Symbols
C19orf27; FAM108A1
NCBI Protein Information
protein ABHD17A
UniProt Protein Name
Protein ABHD17A
UniProt Gene Name
ABHD17A
UniProt Synonym Gene Names
Abhydrolase domain-containing protein 17A
UniProt Entry Name
AB17A_HUMAN

Uniprot Description

ABHD17A: Belongs to the AB hydrolase superfamily. FAM108 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.-.-.-; Secreted; Hydrolase; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: membrane

Molecular Function: protein binding

Similar Products

Product Notes

The FAM108A1 abhd17a (Catalog #AAA1277146) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgggc tgtcgctgag tgagctctgc tgcctcttct gctgcccgcc ctgccccggc cgcatcgctg ccaagctcgc cttcctgccg ccggaggcca cctactccct ggtgcctgag cccgagccgg ggcctggtgg ggccggggcc gcccccttgg ggaccctgag agcctcctcg ggcgcacccg ggcgctggaa gctgcacctg acggagcgtg ccgacttcca gtacagccag cgcgagctgg acaccatcga ggtcttcccc accaagagcg cccgcggcaa ccgcgtctcc tgcatgtatg ttcgctgcgt gcctggtgcc agacaaggac accaggctca gggaggccat ccccagctgg catgggtggg caggctgggc gactccaaca acccagcgcc tggtggttgc ctgctgggcg agagctgggg cacaggggct gccctggcct gcgggtacat ccaccttctc gccaggtaca cggtcctctt ctcgcacggc aatgccgtgg acctgggcca gatgagcagc ttctacattg gcctgggctc ccgcctccac tgcaacatct tctcctacga ctactccggc tacggtgcca gctcgggcag gccttccgag aggaacctct atgccgacat cgacgccgcc tggcaggccc tgcgcaccag gtacggcatc agcccggaca gcatcatcct gtacgggcag agcatcggca cggtgcccac cgtggacctg gcctcgcgct acgagtgtgc cgcggtggtg ctgcactcgc cgctcacctc gggcatgcgc gtcgccttcc ccgacaccaa gaagacctac tgcttcgacg ccttccctaa catcgagaag gtgtccaaga tcacgtctcc cgtgctcatc atccacggca cggaggacga ggtgatcgac ttctcgcacg ggctggcgct ctacgagcgc tgccccaagg cggtggagcc gctgtgggtg gagggcgccg ggcacaacga catcgagctc tacagccagt acctggagcg cctgcgtcgc ttcatctccc aggagctgcc cagccagcgc gcctag. It is sometimes possible for the material contained within the vial of "FAM108A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.