Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM101A cdna clone

FAM101A cDNA Clone

Gene Names
RFLNA; CFM2; FAM101A
Synonyms
FAM101A; FAM101A cDNA Clone; FAM101A cdna clone
Ordering
For Research Use Only!
Sequence
ATGAGGCCCCGGATGCTGCCAGTGTTCTTTGGGGAGAGCATCAAGGTGAACCCGGAACCCACGCATGAGATCCGCTGCAACTCTGAGGTCAAGTACGCCTCGGAGAAGCATTTCCAGGACAAGGTCTTCTATGCGCCTGTACCCACCGTCACGGCCTACAGCGAGACCATCGTGGCAGCACCCAACTGCACGTGGCGCAACTACCGCAGCCAGCTGACCCTGGAGCCACGCCCGCGCGCCCTGCGCTTCCGCAGCACCACCATCATCTTCCCCAAGCATGCCAGGAGCACTTTCCGGACCACCCTGCACTGCAGCCTGGGCCGGCCCAGCCGCTGGTTCACCGCCAGCGTGCAGCTGCAGCTTTGCCAGGACCCTGCCCCCAGCCTCCTGGGCCCTGCCACGCTCTGA
Sequence Length
408
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,464 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 101, member A, mRNA
NCBI Official Synonym Full Names
refilin A
NCBI Official Symbol
RFLNA
NCBI Official Synonym Symbols
CFM2; FAM101A
NCBI Protein Information
filamin-interacting protein FAM101A
UniProt Protein Name
Filamin-interacting protein FAM101A
UniProt Gene Name
FAM101A
UniProt Synonym Gene Names
RefilinA
UniProt Entry Name
F101A_HUMAN

Uniprot Description

FAM101A: Belongs to the FAM101 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 12q24.31

Molecular Function: protein binding

Research Articles on FAM101A

Similar Products

Product Notes

The FAM101A fam101a (Catalog #AAA1269623) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAGGCCCC GGATGCTGCC AGTGTTCTTT GGGGAGAGCA TCAAGGTGAA CCCGGAACCC ACGCATGAGA TCCGCTGCAA CTCTGAGGTC AAGTACGCCT CGGAGAAGCA TTTCCAGGAC AAGGTCTTCT ATGCGCCTGT ACCCACCGTC ACGGCCTACA GCGAGACCAT CGTGGCAGCA CCCAACTGCA CGTGGCGCAA CTACCGCAGC CAGCTGACCC TGGAGCCACG CCCGCGCGCC CTGCGCTTCC GCAGCACCAC CATCATCTTC CCCAAGCATG CCAGGAGCAC TTTCCGGACC ACCCTGCACT GCAGCCTGGG CCGGCCCAGC CGCTGGTTCA CCGCCAGCGT GCAGCTGCAG CTTTGCCAGG ACCCTGCCCC CAGCCTCCTG GGCCCTGCCA CGCTCTGA. It is sometimes possible for the material contained within the vial of "FAM101A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.