FAM100A cdna clone
FAM100A cDNA Clone
Gene Names
UBALD1; FAM100A; PP11303
Synonyms
FAM100A; FAM100A cDNA Clone; FAM100A cdna clone
Sequence
atgtccgtgaacatggacgagctcaagcaccaggtcatgatcaaccagttcgtgctgacggcgggctgcgcggccgaccaggcgaagcaactgctgcaggcggcccactggcagttcgagacagccctcagcgcctttttccaggagaccaacatcccctacagccaccatcaccaccagatgatgtgcacccccgccaatacccctgctacaccccccaacttccctgacgctctcaccatgttctcccgtctcaaggcctccgagagcttccacagcggtggcagcggcagcccgatggccgcgacagccacgtcacccccgccacacttcccccatgccgccaccagcagctctgcggcctccagctggcccacggcggcctcgcccccggggggcccacagcaccaccagccacagccgcccctgtggactccaacacccccttctccggcttcagactggccacccctggccccccaacaggccacctcagaacccagggcccaccctgccatggaggcagagagataa
Sequence Length
534
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,394 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 100, member A, mRNA
NCBI Official Synonym Full Names
UBA like domain containing 1
NCBI Official Symbol
UBALD1
NCBI Official Synonym Symbols
FAM100A; PP11303
NCBI Protein Information
UBA-like domain-containing protein 1
UniProt Protein Name
UBA-like domain-containing protein 1
UniProt Gene Name
UBALD1
UniProt Synonym Gene Names
FAM100A
UniProt Entry Name
UBAD1_HUMAN
Uniprot Description
FAM100A: Belongs to the FAM100 family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 16p13.3
Similar Products
Product Notes
The FAM100A ubald1 (Catalog #AAA1271702) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgtga acatggacga gctcaagcac caggtcatga tcaaccagtt cgtgctgacg gcgggctgcg cggccgacca ggcgaagcaa ctgctgcagg cggcccactg gcagttcgag acagccctca gcgccttttt ccaggagacc aacatcccct acagccacca tcaccaccag atgatgtgca cccccgccaa tacccctgct acacccccca acttccctga cgctctcacc atgttctccc gtctcaaggc ctccgagagc ttccacagcg gtggcagcgg cagcccgatg gccgcgacag ccacgtcacc cccgccacac ttcccccatg ccgccaccag cagctctgcg gcctccagct ggcccacggc ggcctcgccc ccggggggcc cacagcacca ccagccacag ccgcccctgt ggactccaac acccccttct ccggcttcag actggccacc cctggccccc caacaggcca cctcagaacc cagggcccac cctgccatgg aggcagagag ataa. It is sometimes possible for the material contained within the vial of "FAM100A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
