Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAHD2A cdna clone

FAHD2A cDNA Clone

Gene Names
FAHD2A; CGI-105
Synonyms
FAHD2A; FAHD2A cDNA Clone; FAHD2A cdna clone
Ordering
For Research Use Only!
Sequence
atgctggtgtctggtagaagaaggttactcacagttctgctgcaggctcagaagtggccctttcaaccctccagagacatgagactagtgcagttccgggcaccccacctggtggggcctcacttgggcctggagacagggaatggtggaggggttatcaacctcaatgcctttgaccccacactcccgaagacgatgacgcagttcctagagcagggagaggccaccctctcagtggcaagaagagccctggctgcccagttgccagtcctaccacggtcggaggtaaccttcctggctccagtcacacgaccagataaggtggtgtgtgtgggcatgaattatgtggaccactgcaaagaacagaacgtgcccgtgcccaaggagcccatcatcttcagcaagtttgccagctccatcgtggggccctatgatgaggtggtcctcccaccacagagccaggaggtagattgggaagtggagctggccgtggtcattggaaagaaaggcaagcacatcaaggccacagatgctatggcccacgtggccggcttcactgtggctcatgacgtgagtgctcgtgactggcaaatgagacgtaatgggaaacaatggctgctgggaaaaaccttcgacaccttctgccctctgggccctgccttggtgaccaaggacagtgtagcagatccacacaacttaaagatctgctgccgagtgaatggggaagtggtccagagcggcaacaccaaccagatggtattcaagacagaggacctgatagcctgggtctcccagtttgttaccttttacccaggggatgtcatcctaactgggacccccccaggtgtcggtgtattcaggaaacctcctgtctttctcaagaagggggatgaagtccagtgtgagattgaagaactaggtgtcatcatcaacaaggtggtgtga
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,596 Da
NCBI Official Full Name
Homo sapiens fumarylacetoacetate hydrolase domain containing 2A, mRNA
NCBI Official Synonym Full Names
fumarylacetoacetate hydrolase domain containing 2A
NCBI Official Symbol
FAHD2A
NCBI Official Synonym Symbols
CGI-105
NCBI Protein Information
fumarylacetoacetate hydrolase domain-containing protein 2A
UniProt Protein Name
Fumarylacetoacetate hydrolase domain-containing protein 2A
UniProt Gene Name
FAHD2A
UniProt Entry Name
FAH2A_HUMAN

Uniprot Description

FAHD2A: May have hydrolase activity. Belongs to the FAH family.

Protein type: EC 3.-.-.-; Hydrolase; Mitochondrial

Chromosomal Location of Human Ortholog: 2q11.2

Research Articles on FAHD2A

Similar Products

Product Notes

The FAHD2A fahd2a (Catalog #AAA1275834) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggtgt ctggtagaag aaggttactc acagttctgc tgcaggctca gaagtggccc tttcaaccct ccagagacat gagactagtg cagttccggg caccccacct ggtggggcct cacttgggcc tggagacagg gaatggtgga ggggttatca acctcaatgc ctttgacccc acactcccga agacgatgac gcagttccta gagcagggag aggccaccct ctcagtggca agaagagccc tggctgccca gttgccagtc ctaccacggt cggaggtaac cttcctggct ccagtcacac gaccagataa ggtggtgtgt gtgggcatga attatgtgga ccactgcaaa gaacagaacg tgcccgtgcc caaggagccc atcatcttca gcaagtttgc cagctccatc gtggggccct atgatgaggt ggtcctccca ccacagagcc aggaggtaga ttgggaagtg gagctggccg tggtcattgg aaagaaaggc aagcacatca aggccacaga tgctatggcc cacgtggccg gcttcactgt ggctcatgac gtgagtgctc gtgactggca aatgagacgt aatgggaaac aatggctgct gggaaaaacc ttcgacacct tctgccctct gggccctgcc ttggtgacca aggacagtgt agcagatcca cacaacttaa agatctgctg ccgagtgaat ggggaagtgg tccagagcgg caacaccaac cagatggtat tcaagacaga ggacctgata gcctgggtct cccagtttgt taccttttac ccaggggatg tcatcctaac tgggaccccc ccaggtgtcg gtgtattcag gaaacctcct gtctttctca agaaggggga tgaagtccag tgtgagattg aagaactagg tgtcatcatc aacaaggtgg tgtga. It is sometimes possible for the material contained within the vial of "FAHD2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.